Advanced search


Knowledge area




11 results, page 1 of 2

Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

BLANCA ESTELA CHAVEZ SANDOVAL (2015)

106 páginas. Doctorado en Ciencias e Ingeniería Ambientales.

El auge por la utilización de nanopartículas (NPs) de metales nobles en diversos campos, ha derivado en la síntesis inorgánica de NPs metálicas, sin embargo, las metodologías utilizadas para su obtención son generalmente costosas e involucran el uso de químicos peligrosos, es por ello que recientemente ha aumentado el desarrollo de alternativas sustentables y amigables con el ambiente. Sintetizar AuNPs biológicamente es un procedimiento simple, poco costoso y menos perjudicial para el ambiente. El uso de extractos de plantas para la síntesis de nanomateriales aún no se ha explorado completamente, sin embargo, representa una buena alternativa ya que además de las ventajas antes mencionadas se obtienen NPs estables de diferente tamaño y forma. En este trabajo se realizó la síntesis y caracterización de AuNPs, así como su funcionalización con sondas específicas de DNA de dos microorganismos de interés ambiental Achlya sp. y Escherichia coli (E. coli). Achlya sp. es un hongo que infecta peces en piscifactorías, acuarios y embalses naturales; E coli, es una bacteria patógena para los humanos y constituye una fuente de contaminación en alimentos y agua. La sonda o secuencia blanco diseñada para Achlya sp. es: 5’GCACCGGAAGTACAGACCAA3’ y para E.coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ Las AuNPs obtenidas por síntesis química y por síntesis biológica a partir de extractos de laurel, nopal, cebolla, pera y café, fueron funcionalizadas con DNA de Achlya sp. y E. coli y pueden ser utilizadas en el diseño y construcción de biosensores ambientales para detectar a los microorganismos antes mencionados, excepto las NPs de café a pH 9, ya que estas no mostraron mediante caracterización por UV-Vis, una buena funcionalización. Por otro lado, se propone que, para la síntesis biológica, el ácido málico puede estar actuando como agente reductor y el grupo amino como agente estabilizador. Los genosensores permiten monitorear, prevenir y corregir aspectos que causan desequilibrios ecológicos en ambientes acuáticos. Estos nuevos dispositivos analíticos proporcionan información de forma rápida, simple y de bajo costo, comparada con las técnicas de análisis convencionales.

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Doctoral thesis

Organic compounds--Synthesis. Transition metal catalysts. Nanostructured materials--Synthesis. Green chemistry. Síntesis orgánica. Catalizadores metálicos. QD262 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS PROCESOS QUÍMICOS

ZIF’s como soporte catalítico y fuente primaria de carbono en la síntesis de materiales nanoestructurados de carbono y su aplicación en el almacenamiento de hidrógeno

MARIA JOSE MARTIN MARTINEZ (2020)

113 páginas. Maestría en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

En la actualidad, el uso desmedido de los combustibles fósiles, debido al crecimiento de la población, ha provocado problemas ambientales severos, como lo es el calentamiento global. Por ello, la búsqueda de nuevos combustibles limpios como el metanol e hidrógeno ha tenido un gran crecimiento, principalmente en el almacenamiento de este último. En el presente trabajo se planteó la síntesis verde de diferentes materiales ZIFs (ZIF-67, basados en Co y Ni); estos materiales, debido a sus propiedades, son competentes para el almacenamiento de hidrógeno y, además, como catalizadores en la síntesis de nanotubos de carbono. Se estudiaron tres tipos de síntesis verdes, con la finalidad de disminuir los contaminantes que se pueden generar en el proceso; el método hidrotermal, método ionotermal (usando un solvente eutéctico profundo) y el método mecanoquímico (solamente el método hidrotermal está reportado en la literatura para la síntesis de este material). Posteriormente, a estos materiales sintetizados se les realizaron pruebas para evaluar su eficiencia en el almacenamiento de hidrógeno. Por último, los ZIFs sintetizados se emplearon en el crecimiento de nanotubos de carbono por el método CVD, donde estos ZIFs se usaron como una fuente primaria de carbono. Finalmente, todos los materiales sintetizados (ZIFs y NTCs) fueron caracterizados por diferentes técnicas analíticas tales como: Difracción de rayos-X, espectroscopia FT-IR, espectroscopia Raman, microscopia electrónica de barrido, espectroscopia de rayos-X dispersivos y por fisisorción de nitrógeno. Para el caso del almacenamiento de hidrógeno los ZIF-67(Co) sintetizados por los métodos hidrotermal e ionotermal obtuvieron los mejores resultados (4.74% y 3.04%, respectivamente).

Master thesis

Nanoparticles--Environmental aspects. Nanostructured materials--Synthesis. Nanochemistry. Green chemistry. Química verde. Materiales nanoestructurados. Nanotubos. TA418.9.N35 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS TECNOLOGÍA DE LA CATÁLISIS

Synthesis of Metforminium Succinate by Melting. Crystal Structure, Thermal, Spectroscopic and Dissolution Properties

Synthesis of Metforminium Succinate by Melting. Crystal Structure, Thermal, Spectroscopic and Dissolution Properties

EDUARDO PLATA VARGAS Cinthia Yareli De la Cruz Hernández ALEJANDRO DORAZCO GONZALEZ INES FUENTES NORIEGA DAVID MORALES MORALES JUAN MANUEL GERMAN ACACIO (2017)

The reaction by melt mixing at 220 °C of the antihypergly-cemic drug metformin hydrochloride1with dehydrated sodium suc-cinate yields efficiently the organic salt [MET]2[SUC]2(H-MET+=metforminium and SUC2-= succinate). Solid state CPMAS NMR13Cspectroscopy experiments, powder X-ray diffraction and FT-IR re-sults support the formation of the pharmaceutical salt2in goodyields. Besides, thecharged-assisted hydrogen bonding interactionsof type N-H...-O(carboxylate) were thoroughly analyzed by singlecrystal X-Ray diffraction techniques. Thus, the pharmaceutical salt2possesses considerable thermal differences when compared to thepure starting reagents. In addition, intrinsic dissolution rate expe-riments in buffered aqueous solutions at pH= 6.8 showed a sus-tained-release behavior of the drug in2with a constant value ofKint= 0.885 mg/min * cm2.

Article

Química Diabetes Metformin X-ray structures ssCPMAS NMR13C Melting Succinate mechanochemistry green chemistry Química Diabetes Metformin X-ray structures ssCPMAS NMR13C Melting Succinate mechanochemistry green chemistry BIOLOGÍA Y QUÍMICA

Nature of petrological, geochemical, geochronological settings and evolution of bundelkhand greenstone complexes in the Bundelkhand Craton, India

PRADIP KUMAR SINGH (2019)

This doctoral thesis describes the geology, petrography, geochemistry, mineralogy, Sm–Nd isotope geochemistry and geochronology of mafic–ultramafic rocks, TTG (tonalite-trondhjemite-granodiorite) gneisses and high-K granitoids to decipher the nature and origin of the geodynamic changes that took place between ~3.59 and 2.50 Ga in the Central Bundelkhand Greenstone Complex (CBGC), Bundelkhand Craton (BC), India. The CBGC consists of mainly two greenstone belts: (1) the Babina greenstone belt (2) the Mauranipur greenstone belt. The petrography and mineral assemblages of these mafic–ultramafic volcanic rocks indicate that they experienced greenschist to amphibolite facies metamorphism. The mafic volcanic rocks from the Babina belt are characterized by SiO2 = 43.9–51.2 wt%, MgO = 5.4–11.0 wt% and Mg# = 44–77 [Mg# = 100 × (Mg2+/(Mg2+ + Fe2+))], whereas those from the Mauranipur belt are characterized by higher silica (51.8–55.6 wt%), MgO = 6.9–9.5 wt% and Mg# = 59–70. The ultramafic rocks of the Babina and Mauranipur belts contain SiO2 = 46.9–50.3 wt%, MgO = 20.2–21.1 wt% and Mg# = 77–82. The Babina mafic rocks show a nearly flat REE and HFSE profile [(La/Yb)CN = 0.87–1.40] with negative Nb (Nb/Nb* = 0.13–0.77) and positive Pb anomalies that could be attributed to subduction-related metasomatic agents. On the other hand, the Mauranipur mafic rocks have total REE (26.0–40.7 ppm) and display flat chondrite normalized LREE [(La/Yb)CN = 1.1–1.7; (La/Sm)CN = 1.1–2.0] with no Eu anomalies (Eu/Eu* = 0.89–1.0) and negative Nb anomalies (Nb/Nb* = 0.13–0.77), which are most probably the effects of crustal contamination. Additionally, the whole-rock isotopic (Sm–Nd) data of the mafic–ultramafic volcanic rocks from the Babina belt yield an isochron age of ~3.44 Ga, which represents the first estimation of the age of these rocks. Isotopic and geochemical characteristics of mafic–ultramafic volcanic rocks of the CBGC reveal that they were generated from a mantle source with long-term depletion. The outcrops mafic–ultramafic volcanic rocks in the Babina and Mauranipur belts are remnants of oceanic crust possibly emplaced in a subduction-related setting. LA-SF-ICP-MS zircon dating reveals that TTG magmatism mainly developed around ~3.51–3.20 Ga at regular intervals of 100 Myr although it has also found evidence of younger Neoarchean TTG magmatism at 2.71–2.67 Ga."

Doctoral thesis

Archean TTG Greenstone Bundelkhand Craton Sanukitoids CIENCIAS FÍSICO MATEMÁTICAS Y CIENCIAS DE LA TIERRA CIENCIAS DE LA TIERRA Y DEL ESPACIO GEOLOGÍA GEOLOGÍA

Estimation of radiated energy using the EGF technique: what should be the upper limit of integration in the frequency domain?

Shri Krishna Singh (2007)

The empirical Green's function (EGF) technique is frequently used to estimate the radiated seismic energy, ER, of an earthquake. An approximation of the moment-rate spectrum, M0(f), of the target earthquake is obtained from the ratio of the spectrum of the target earthquake to the spectrum of the EGF earthquake, and the radiated seismic energy is computed by integrating f2M0 2(f) over frequency f. The choice of the upper limit of integration, fu, is critical. In this note we show that the optimum choice of fu, for the ω2-source model is given by fu/fc1∼ fc2/fc1, where fc1 and fc2 are the corner frequencies of the target and the EGF earthquakes, respectively. This result provides a useful guide in the application of the EGF technique to obtain a reliable estimate of the radiated seismic energy.

Article

TERREMOTOS ANÁLISIS EMPÍRICO MÉTODO DE ESTIMACIÓN FUNCIÓN VERDE ANÁLISIS DE FIABILIDAD SISMICIDAD Earthquake Empirical analysis Estimation method Green function Reliability analysis Seismicity CIENCIAS FÍSICO MATEMÁTICAS Y CIENCIAS DE LA TIERRA CIENCIAS DE LA TIERRA Y DEL ESPACIO GEOFÍSICA SISMOLOGÍA Y PROSPECCIÓN SÍSMICA concept8601 Seismology

Estudios teórico-computacionales sobre las interacciones entre moléculas antioxidantes y grafeno y sus nuevos derivados

BRENDA MANZANILLA VIVEROS (2021)

En este trabajo se presenta el estudio con Teoría de Funcionales de la Densidad (DFT, Density Funtional Theory) de diversos modelos finitos de grafeno y algunos de sus derivados, así como de antioxidantes endógenos como melatonina y algunos de sus análogos, y exógenos como el ácido chicórico (CA), la curcumina y el éster fenetílico del ácido cafeico (CAPE), para formar nanovectores que ayuden a reducir el estrés oxidativo. En la primera parte del proyecto se analizó el cambio en las propiedades químicas de diversos modelos finitos de grafeno y algunos de sus derivados, como son grafeno dopado con boro (B), nitrógeno (N) o fósforo (P), grafano, fluorografeno, grafino, grafidiino y óxido de grafeno. Para ello, se usaron los descriptores globales y locales de la reactividad de la DFT Conceptual, cambios estructurales y, además, se analizó la posible toxicidad de los distintos modelos finitos de grafeno. De estos, se seleccionaron al óxido de grafeno y al fluorografeno como posibles vehículos para el transporte de antioxidantes. En la segunda y tercera parte del proyecto se analizaron distintas propiedades de los antioxidantes endógenos y exógenos, para diseñar nuevos antioxidantes que puedan frenar el estrés oxidativo. Por lo que, se calcularon los descriptores para estimar la biodisponibilidad, se calculó el valor del pKa, la energía de solvatación, se estimó la toxicidad y mecanismos de reacción primarios como son la transferencia electrónica simple (SET) y la transferencia de átomos de hidrógeno (HAT); así como la inhibición de una enzima productora de radicales libres, xantina oxidasa. De este análisis se confirma que CAPE y CA son buenos antioxidantes. Finalmente, se diseñaron nanovectores conformados por los derivados de grafeno con los descriptores más adecuados (óxido de grafeno y fluorografeno), que responderán a estímulos redox para el transporte y liberación dirigida de los antioxidantes y, así, coadyuvar a a frenar el alto estrés oxidativo que origina múltiples enfermedades.

This research thesis presents a study within Density Functional Theory (DFT) of various finite models of graphene and some of its derivatives, endogenous melatonin and some analogs and exogenous antioxidants such as chicoric acid (CA), curcumin, and caffeic acid phenethyl ester (CAPE) to form nanovectors that help reduce oxidative stress. In the first part of the project, the change in different graphene finite models' chemical properties and some of their derivatives, such as graphene doped with boron (B), nitrogen (N), or phosphorus (P), graphane, fluorographene, graphyne, graphdiyne, and graphene oxide, were analyzed. For this purpose, we analyzed the global and local descriptors of the Conceptual DFT reactivity, structural changes, and the possible toxicity of the different graphene finite models. Graphene oxide and fluorographene were selected to be potential drug delivery vehicles for antioxidants transport. In the second and third part of this project, different endogenous and exogenous antioxidants were analyzed to design new antioxidants to stop oxidative stress. For this, chemical properties were studied through calculation of the global descriptors like, the value of pKa, solvation energy, toxicity, and the primary reaction mechanisms such as the simple electron transfer (SET) and hydrogen atom transfer (HAT); as well as the inhibition of a free radical-producing enzyme, xanthine oxidase. According to our results, CAPE and CA are good antioxidants. Finally, nanovectors made up of selected graphene derivatives (graphene oxide and fluorographene), were designed to respond to redox stimuli for the transport and targeted release of antioxidants. Our designed nanovectors are new potential systems, thus aiding to stop the high oxidative stress that causes multiple diseases.

Doctoral thesis

CGU- Doctorado en Química BIOLOGÍA Y QUÍMICA CIENCIAS TECNOLÓGICAS TECNOLOGÍA BIOQUÍMICA Grafeno – Derivados Índices de reactividad Química teórica y computacional DFT Conceptual (Teoría de Funcionales de la Densidad) Nanovectores Moléculas antioxidantes Graphene - Derivatives Reactivity indexes Theoretical and computational chemistry Conceptual DFT (Density Functional Theory) Nanovectors Antioxidant molecules

Caracterización de la respuesta de la interferometría sísmica en medios unidimensionales y bidimensionales: teoría y caso de estudio el Valle de México

Carlos Orlando Jiménez González (2017)

En este trabajo, se usaron modelos matemáticos para estimarla respuesta sísmica de medios heterogéneos, anisótropos y dispersivos. Se validó la metodología usada para obtener la función de Green aproximada para un medio acústico tridimensional con un gradiente de la velocidad constante; dicha validación, se realizó comparando la solución aproximada con la solución analítica de Pekeris.Se utilizó un modelo de un medio estratificado sobre un semiespacio para estudiar y analizar la naturaleza de campos deconvolucionados. Este modelo estratificado, también, se usó para interpretar datos reales. Los registros utilizados corresponden a las estaciones Chapultepec y Kennedy; las cuales están ubicadas en el valle de México,en la zona de terreno duro y en la zona lacustre, respectivamente; donde se estimaron velocidades de propagación para ondas de corte y compresionales; para este propósitos e usaron seis eventos registrados en el pozo Chapultepec y once eventos detectados en el pozo Kennedy. Para el pozo Chapultepec se estimaron velocidades efectivas (?) de441 y 595 m/s a 22 y 52 m de profundidad, respectivamente. En el pozo de la Unidad Kennedy, se estimaron velocidades efectivas (?) de 44 y 167 m/s a 30 y 83 m de profundidad, respectivamente. Con las velocidades estimadas fue posible caracterizar el subsuelo donde se ubica la estación Kennedy estimando un módulo de Young efectivo de 98937689 N/m2a 83 metros de profundidad; además, módulos de elasticidad de cortante (?), de 2381250 y 39417745 N/m2a 30 y 83 metros de profundidad.

Doctoral thesis

INGENIERÍA Y TECNOLOGÍA Deconvolución Función de Green Interferometría sísmica

Síntesis de una membrana con líquido iónico de tercera generación, su evaluación en separación de CO2 y su captura en un cultivo hidropónico

CINTHIA ERIKA SANCHEZ FUENTES (2016)

101 páginas. Doctorado en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

En la presente investigación se sintetizaron cuatro membranas soportadas con líquidos iónicos (SILM) para evaluarlas en la separación de CO2 de la mezcla CO2/N2. Dos de ellos funcionalizados con un grupo amina en la parte catiónica, triflato de 1-(2-aminoetil)-3-metilimidazolio ([AEMIm]Tf) y tetrafluoroborato de 1-(2-aminoetil)-3-metilimidazolio ([AEMIm]BF4), el tercero posee el grupo amino en la parte aniónica, antranilato de trioctilmetilamonio ([TOMA]An) y el cuarto, el oleato de trietilmetilamonio ([TOMA]Ol). La estructura química de los líquidos iónicos se determinó por las espectroscopias de Resonancia Magnética Nuclear (NMR) y de Infrarrojo por Transformada de Fourier (FTIR), las propiedades térmicas se estudiaron con Análisis Termogravimétrico (TGA) y la densidad se determinó con un picnómetro. El nivel de impregnación y la distribución de los líquidos iónicos en el soporte tubular de alúmina se obtuvieron mediante Microscopía Electrónica de Barrido acoplado con Espectroscopia de Dispersión de Rayos X (SEM-EDX). Las propiedades de transporte de los gases se evaluaron por el método de volumen variable utilizando gases puros, a 30 °C y a 1, 2 y 3 bar, y mezcla de los mismos con una relación volumétrica de 50/50. La SILM [TOMA]An presentó el mayor valor para la selectividad con 70, además con esta membrana se obtuvo el mejor balance de perúselectividad superando los límites en la gráfica de Robeson. Las SILM con grupos amino reaccionaron con el CO2 para obtener el grupo químico carbamato. Los estudios de estabilidad térmica e infrarrojo sugieren que este grupo es estable aún después de haber iniciado el proceso de descomposición del líquido iónico. Para dar un valor agregado al uso del CO2, se enriqueció un invernadero de cultivo de lechuga hidropónico con este gas y se observó un efecto de aceleración del crecimiento.

In the present research work, four membranes supported with ionic liquids (SILMs) were synthesized to be evaluated in the CO2 separation from the CO2/N2 mixture. As for the ionic liquids, two of them were functionalized with an amino group at the cationic part, 1-(2-aminoethyl)-3-methylimidazolium triflate ([AEMIm]Tf) and 1-(2-aminoethyl)-3-methylimidazolium tetrafluoroborate ([AEMIm]BF4), the third and fourth ionic liquids possessed the amino group at the anionic part, trioctylmethylammonium anthranilate ([TOMA]An) and triethylmethylammonium oleate ([TOMA]Ol). The chemical structure of the ionic liquids was confirmed by nuclear magnetic resonance (NMR) and Fourier transform infrared (FTIR) spectroscopies; the thermal properties were studied by thermogravimetric analysis (TGA) and density was measured with a pycnometer. The impregnation degree and distribution of the ionic liquids in an alumina tubular support were established by means of scanning electron microscopy coupled with energy dispersive X-ray spectroscopy (SEM-EDX). The transport properties of the gases were evaluated by the variable volume method using pure gases and their mixtures with a 50/50 volumetric ratio at 30 °C and 1, 2 and 3 bar. The SILM [TOMA]An showed the highest selectivity (70) and the best permselectivity balance, surpassing the limits in the Robeson plot. The SILMs with amino groups reacted with CO2 to obtain the carbamate chemical group. The thermal stability and infrared studies suggest that this group is stable even after the beginning of the decomposition process of the ionic liquid. In order to provide an added value to the use of CO2, a lettuce hydroponic greenhouse was enriched with this gas, observing an accelerated growing effect.

Doctoral thesis

Ionic solutions. Membranes (Technology). Greenhouse gases--Environmental aspects. Soluciones iónicas. Membranas (Tecnología). QD543 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA DEL MEDIO AMBIENTE INGENIERÍA DE LA CONTAMINACIÓN