Advanced search


Knowledge area




4966 results, page 1 of 10

Construcción y caracterización de un cristal artificial elástico

FILIBERTO RAMIREZ RAMIREZ (2021)

In order to achieve the main objective, a design of a supercell or basic cell consisting of an array of elastic units will be made. This supercell will be obtained from a locally periodic structure of coupled blocks, whose central block will be deformed; later, the one-dimensional elastic artificial crystal will be built, which will be characterized experimentally and understood from a strong mooring model. The locally proposed system consists of a set of vibrating bars, identical, coupled together, imitating a set of " defectsin a one-dimensional periodic network and with a periodic coupling. It is expected that the acoustic wave amplitudes of this system show similar characteristics to the wave functions of an electron strongly linked in an eective potential generated by a one-dimensional network of atoms. In the locally periodic system that we propose the vibrating elastic units will be coupled together by means of locally periodic rods; since, in these we can control the resonance frequencies and the same frequency of normal resonance. Furthermore, in these rods, the lower energy vibration modes can be isolated from the rest of the excited states. When the resonance frequency of the elastic unit (defect) is in the gap of the coupler (locally periodic rod) the wave amplitude will be located. To generate the emergence of a new band in the second torsion spectrum gap, from an originally periodic system, using the transfer matrix method for torsional waves, six elastic structures formed by 1, 2, 3 and up to 6 were designed. coupled supercell The neighboring levels of the emerging band is separated to a maximum distance of 100 Hz to facilitate its detection. This band is in the frequency range of 26450 to 26650 kHz.

En esta tesis se estudia experimentalmente las vibraciones de sistemas formados por arreglos de unidades elásticas acopladas, que pueden ser descritas por un modelo de enlace fuerte. Después de haber probado diversos métodos de acoplamiento mecánico, entre dos unidades elásticas, en el sistema se eligió como el más adecuado un subsistema localmente periódico que sería utilizado como acoplador de las mismas, entre sí. Los distintos sistemas elásticos fabricados, bajo diseño específico, se caracterizan por el método de espectroscopia acústica resonante (ARS) y se comparan los resultados experimentales con los obtenidos usando un modelo de enlace fuerte. El objetivo de esta tesis es diseñar y caracterizar un cristal artificial elástico unidimensional con propiedades espectrales de un cristal atómico. Para ello se diseñó primero una supercelda o celda básica unitaria apropiada. Esta supercelda se obtuvo a partir de una estructura localmente periódica de celdas elásticas simples idénticas, uno de cuyos bloques se deforman en longitud, por lo que le denominamos el defecto dentro de la estructura periódica o impureza (ver gura 4.1). Mediante la deformación de la celda simple es posible aislar los modos de vibración de la banda de transmisión y forzarlos a aparecer dentro de las brechas que aparecen en el sistema periódico original (ver figura 3.2). Esto origina que la amplitud de onda torsional se localice dando lugar a una fenomenología análoga a la de los cristales atómicos que son descritos a través de un modelo de enlace fuerte. Habiendo conseguido un diseño que presenta las características adecuadas, tanto para la realización del modelo, como de la medición experimental se construye y se caracteriza experimentalmente.

Doctoral thesis

Crystals. Elasticity. Spectroscopy. Spectrum Analysis--methods. Cristales. QD933 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS TECNOLOGÍA DE MATERIALES

Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

BLANCA ESTELA CHAVEZ SANDOVAL (2015)

106 páginas. Doctorado en Ciencias e Ingeniería Ambientales.

El auge por la utilización de nanopartículas (NPs) de metales nobles en diversos campos, ha derivado en la síntesis inorgánica de NPs metálicas, sin embargo, las metodologías utilizadas para su obtención son generalmente costosas e involucran el uso de químicos peligrosos, es por ello que recientemente ha aumentado el desarrollo de alternativas sustentables y amigables con el ambiente. Sintetizar AuNPs biológicamente es un procedimiento simple, poco costoso y menos perjudicial para el ambiente. El uso de extractos de plantas para la síntesis de nanomateriales aún no se ha explorado completamente, sin embargo, representa una buena alternativa ya que además de las ventajas antes mencionadas se obtienen NPs estables de diferente tamaño y forma. En este trabajo se realizó la síntesis y caracterización de AuNPs, así como su funcionalización con sondas específicas de DNA de dos microorganismos de interés ambiental Achlya sp. y Escherichia coli (E. coli). Achlya sp. es un hongo que infecta peces en piscifactorías, acuarios y embalses naturales; E coli, es una bacteria patógena para los humanos y constituye una fuente de contaminación en alimentos y agua. La sonda o secuencia blanco diseñada para Achlya sp. es: 5’GCACCGGAAGTACAGACCAA3’ y para E.coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ Las AuNPs obtenidas por síntesis química y por síntesis biológica a partir de extractos de laurel, nopal, cebolla, pera y café, fueron funcionalizadas con DNA de Achlya sp. y E. coli y pueden ser utilizadas en el diseño y construcción de biosensores ambientales para detectar a los microorganismos antes mencionados, excepto las NPs de café a pH 9, ya que estas no mostraron mediante caracterización por UV-Vis, una buena funcionalización. Por otro lado, se propone que, para la síntesis biológica, el ácido málico puede estar actuando como agente reductor y el grupo amino como agente estabilizador. Los genosensores permiten monitorear, prevenir y corregir aspectos que causan desequilibrios ecológicos en ambientes acuáticos. Estos nuevos dispositivos analíticos proporcionan información de forma rápida, simple y de bajo costo, comparada con las técnicas de análisis convencionales.

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Doctoral thesis

Organic compounds--Synthesis. Transition metal catalysts. Nanostructured materials--Synthesis. Green chemistry. Síntesis orgánica. Catalizadores metálicos. QD262 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS PROCESOS QUÍMICOS

Síntesis de una membrana con líquido iónico de tercera generación, su evaluación en separación de CO2 y su captura en un cultivo hidropónico

CINTHIA ERIKA SANCHEZ FUENTES (2016)

101 páginas. Doctorado en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

En la presente investigación se sintetizaron cuatro membranas soportadas con líquidos iónicos (SILM) para evaluarlas en la separación de CO2 de la mezcla CO2/N2. Dos de ellos funcionalizados con un grupo amina en la parte catiónica, triflato de 1-(2-aminoetil)-3-metilimidazolio ([AEMIm]Tf) y tetrafluoroborato de 1-(2-aminoetil)-3-metilimidazolio ([AEMIm]BF4), el tercero posee el grupo amino en la parte aniónica, antranilato de trioctilmetilamonio ([TOMA]An) y el cuarto, el oleato de trietilmetilamonio ([TOMA]Ol). La estructura química de los líquidos iónicos se determinó por las espectroscopias de Resonancia Magnética Nuclear (NMR) y de Infrarrojo por Transformada de Fourier (FTIR), las propiedades térmicas se estudiaron con Análisis Termogravimétrico (TGA) y la densidad se determinó con un picnómetro. El nivel de impregnación y la distribución de los líquidos iónicos en el soporte tubular de alúmina se obtuvieron mediante Microscopía Electrónica de Barrido acoplado con Espectroscopia de Dispersión de Rayos X (SEM-EDX). Las propiedades de transporte de los gases se evaluaron por el método de volumen variable utilizando gases puros, a 30 °C y a 1, 2 y 3 bar, y mezcla de los mismos con una relación volumétrica de 50/50. La SILM [TOMA]An presentó el mayor valor para la selectividad con 70, además con esta membrana se obtuvo el mejor balance de perúselectividad superando los límites en la gráfica de Robeson. Las SILM con grupos amino reaccionaron con el CO2 para obtener el grupo químico carbamato. Los estudios de estabilidad térmica e infrarrojo sugieren que este grupo es estable aún después de haber iniciado el proceso de descomposición del líquido iónico. Para dar un valor agregado al uso del CO2, se enriqueció un invernadero de cultivo de lechuga hidropónico con este gas y se observó un efecto de aceleración del crecimiento.

In the present research work, four membranes supported with ionic liquids (SILMs) were synthesized to be evaluated in the CO2 separation from the CO2/N2 mixture. As for the ionic liquids, two of them were functionalized with an amino group at the cationic part, 1-(2-aminoethyl)-3-methylimidazolium triflate ([AEMIm]Tf) and 1-(2-aminoethyl)-3-methylimidazolium tetrafluoroborate ([AEMIm]BF4), the third and fourth ionic liquids possessed the amino group at the anionic part, trioctylmethylammonium anthranilate ([TOMA]An) and triethylmethylammonium oleate ([TOMA]Ol). The chemical structure of the ionic liquids was confirmed by nuclear magnetic resonance (NMR) and Fourier transform infrared (FTIR) spectroscopies; the thermal properties were studied by thermogravimetric analysis (TGA) and density was measured with a pycnometer. The impregnation degree and distribution of the ionic liquids in an alumina tubular support were established by means of scanning electron microscopy coupled with energy dispersive X-ray spectroscopy (SEM-EDX). The transport properties of the gases were evaluated by the variable volume method using pure gases and their mixtures with a 50/50 volumetric ratio at 30 °C and 1, 2 and 3 bar. The SILM [TOMA]An showed the highest selectivity (70) and the best permselectivity balance, surpassing the limits in the Robeson plot. The SILMs with amino groups reacted with CO2 to obtain the carbamate chemical group. The thermal stability and infrared studies suggest that this group is stable even after the beginning of the decomposition process of the ionic liquid. In order to provide an added value to the use of CO2, a lettuce hydroponic greenhouse was enriched with this gas, observing an accelerated growing effect.

Doctoral thesis

Ionic solutions. Membranes (Technology). Greenhouse gases--Environmental aspects. Soluciones iónicas. Membranas (Tecnología). QD543 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA DEL MEDIO AMBIENTE INGENIERÍA DE LA CONTAMINACIÓN

Marco Jurídico en producción lechera

BLANCA PATRICIA PEÑA REVUELTA (2014)

"La Constitución Política de los Estados Unidos Mexicanos, (1917) vigente, no establece una normatividad que rija el procedimiento en materia de inocuidad de la leche a nivel federal. En el Artículo 27, Fracción XX, suscribe: “El Estado promoverá las condiciones para el Desarrollo Rural Integral, con el propósito de generar empleo y garantizar a la población campesina bienes y su participación e incorporación en el Desarrollo Nacional, y fomentará la actividad agropecuaria y forestal para el óptimo uso de la tierra, con obras de infraestructura, insumos, créditos, servicios de capacitación y asistencia técnica. Asimismo expedirá la legislación reglamentaria, para planear y organizar la producción agropecuaria, su industrialización y comercialización, considerándolas de interés público”. Adicionada mediante decreto publicado en el Diario Oficial de la Federación el 3 de febrero de 1983. La normatividad en materia de producción lechera a nivel nacional se encuentra establecida en: Ley de Sanidad Animal, Ley General de Salud, Ley sobre Metrología y Normalización y sus respectivos reglamentos. Así mismo en las Normas Oficiales Mexicanas expedidas por la Comisión Nacional de Normalización y en base al ámbito de aplicación por las Secretarías de estado: SAGARPA, SS, STPS y las dependencias interiores de cada una. Por lo que se refiere a lo local, existen las leyes estatales de ganadería. No existe en la legislación mexicana, normas que se refieran a la producción lechera a nivel municipal. Debido a su importancia, las actividades y programas destinados a este sector por parte de la SAGARPA y de organismos desconcentrados como Apoyos y Servicios a la omercialización Agropecuaria (ASERCA, 2012) están dirigidos a impulsar el desarrollo integral y diversificado del subsector pecuario, mejorar su productividad y competitividad sin deterioro del ambiente, aumentar los ingresos de los productores, así como ampliar la oferta y la calidad de alimentos, incluida la expansión del comercio exterior. La producción lechera debe examinarse en un contexto mundial dinámico y en evolución como parte del proceso de globalización, que se caracteriza generalmente por el aumento del comercio internacional, la mayor integración de los mercados, la adopción más rápida de nuevas tecnologías, la transmisión de información. Todos estos aspectos tienen consecuencias sustanciales, tanto positivas como negativas, con respecto a la producción lechera y a la elaboración de un enfoque que abarque toda la cadena alimentaria. La organización de la Agricultura y la Alimentación (FAO) tiene una activa participación en programas de producción lechera. La Dirección de Alimentación y Nutrición (ESN) hospeda a la Secretaría Mixta de la Comisión del Codex Alimentarius (CAC), la cual ha llevado a cabo el Programa Conjunto FAO/OMS sobre Normas Alimentarias durante más de cuarenta años."

"The Constitution of the United Mexican States, 1917) in force, does not establish a procedure governing regulations regarding safety of milk at the federal level. In Article 27, Section XX, subscribes: "The State shall promote conditions for Integrated Rural Development, in order to generate employment and provide goods to the rural population and their participation and inclusion in the National Development and encourage agricultural activity and Forestry for the optimum use of the land, infrastructure, inputs, credit, training and technical assistance. Also issued regulatory legislation, planning and organizing agricultural production, industrialization and commercialization, considering the public interest. "Added by order published in the Official Journal of the Federation on February 3, 1983. The norms on national milk production is set to: Animal Health Law, Health Law, Law on Metrology and Standardization and their respective regulations. Also in the Mexican Official Standards issued by the National Standards Commission and based on the scope of the Secretaries of State: SAGARPA, SS, STPS and the interior rooms of each. In regard to local, state laws exist livestock. There Mexican law, rules relating to milk production at the municipal level. Because of its importance, activities and programs to this sector by the SAGARPA and decentralized organizations as Support Services for Agricultural Marketing (ASERCA, 2012) are aimed to promote the integral development of the livestock sub-sector and diversified, improve their productivity and competitiveness without environmental damage, increase farmers' incomes and increase the supply and quality of food, including the expansion of foreign trade. Milk production should be considered in a global dynamic and evolving as part of the globalization process, which is generally characterized by the growth of international trade, the increased integration of markets, the faster adoption of new technologies, the transmission of information . All these aspects have significant consequences, both positive and negative, with respect to milk production and the development of an approach that encompasses the entire food chain. The organization of the Food and Agriculture Organization (FAO) has an active participation in dairy production. The Food and Nutrition (ESN) hosts the Joint Secretariat of the Codex Alimentarius Commission (CAC), which has conducted the Joint FAO / WHO Food Standards for over forty years."

Master thesis

Producción lechera Normatividad CIENCIAS AGROPECUARIAS Y BIOTECNOLOGÍA

Efectos de insecticidas químicos sobre dos enemigos naturales del psílido del tomate Bactericera cockerelli (Homoptera: Triozidae), Tamarixia triozae (Hymenoptera: Eulophidae) y Engytatus varians (Hemiptera: Miridae)

Sinue Isabel Morales Alonso (2019)

Instituto de Investigaciones Agropecuarias y Forestales. Instituto de Investigaciones sobre los Recursos Naturales. Instituto de Investigaciones Químico Biológicas. Facultad de Biología. Facultad de Medicina Veterinaria y Zootecnia. Facultad de Químico Farmacobiología. Programa Institucional de Doctorado en Ciencias Biológicas

The ectoparasitoid Tamarixia triozae (Hymenoptera: Eulophidae) and the predator Engytatus varians (Hemiptera: Miridae) are two important natural enemies (NE) of the tomato psyllid Bactericera cockerelli (Sulcer) (Hemiptera: Triozidae), one of the most detrimental pests of several solanaceous crops in Mexico. The B. cockerelli populations are controlled with insecticides of different toxicological groups that can affect NE and compromise their performance. The objective of this work was to know the lethal and sublethal effects of insecticides on these NE. In the first part of this study, the parasitism, host feeding, and transgenerational effects of T. triozae females exposed, in egg, larval, and pupal stages, to the insecticides refined soybean oil, imidacloprid, and abamectin were evaluated. Three concentrations of each compound were used: minimum field-registered concentration (MiFRC), one-half the MiFRC (½MiFRC), and LC50 for B. cockerelli fourth-instars, the most preferred stage by the parasitoid. The parasitoid had access to a mixture of host instars (2nd, 3rd, 4th, and 5th) for parasitism and feeding. In general, the parasitism was significantly higher on 4th instars (42-96%), followed by 5th (0-81%) and 3rd instars (6-59%) of the host, across all treatments. No parasitism on 2nd instars was observed. Tamarixia triozae females consumed more B. cockerelli 2nd instars (11-70%), followed by 3rd (12-50%), 4th (0-22%), and 5th instars (0- 17%). Any insecticide modified the sex ratio in the F2 generation. In the second part of this study, the degradation of spinosad, flufenoxuron, imidacloprid, and dimethoate, sprayed on tomato plants (Solanum lycopersicum L.) in the greenhouse, as well as the residuality of these compounds on E. varians adults was evaluated.

El ectoparasitoide Tamarixia triozae (Hymenoptera: Eulophidae) y el depredador Engytatus varians (Hemiptera: Miridae) son dos enemigos naturales (EN) del psílido del tomate, Bactericera cockerelli (Sulcer) (Hemiptera: Triozidae), una de las plagas más destructivas de diversos cultivos de solanáceas en México. Las poblaciones de B. cockerelli se combaten con insecticidas de distintos grupos toxicológicos que pueden afectar a los EN y comprometer su desempeño. El objetivo de este trabajo fue conocer los efectos letales y subletales de los insecticidas sobre estos EN. En la primera parte de este estudio se evaluó el parasitismo, alimentación y los efectos transgeneracionales de las hembras de T. triozae expuestas, en etapa de huevo, larva y pupa, a aceite refinado de soya, imidacloprid y abamectina. Se usaron tres concentraciones de cada compuesto: concentración mínima registrada en campo (CMiRC), la mitad de la CMiRC (½CMiRC) y la concentración letal media (CL50) para ninfas de cuarto ínstar de B. cockerelli, el cual es el ínstar más preferido por el parasitoide. El parasitoide tuvo acceso a una mezcla de ínstares del huésped (2do, 3ro, 4to y 5to) para parasitismo y alimentación. En general, el parasismo fue significativamente mayor sobre las ninfas de 4to ínstar (42-96%), seguido por las de 5to (0-81%) y 3ro (6-59%). No se registró parasitismo sobre las ninfas de 2do ínstar. Las hembras de T. triozae consumieron más ninfas de 2do ínstar (11- 70%) de B. cockerelli, seguido por las de 3ro (12-50%), 4to (0-22%) y 5to ínstar (0-17%). Ninguno de los insecticidas modificó la proporción sexual en la generación F2. En la segunda parte de este trabajo, se evaluó la degradación de spinosad, flufenoxuron, imidacloprid y dimetoato, cuando se asperjaron sobre plantas de Solanum lycopersicum L. (tomate) en invernadero, así como la residualidad de estos compuestos sobre los adultos de E. varians.

Doctoral thesis

CIENCIAS AGROPECUARIAS Y BIOTECNOLOGÍA IIAF-D-2019-1370 Opción en ciencias agropecuarias, forestales y ambientales Psílido de la papa Enemigos naturales Insecticidas

Comportamiento reproductivo y producción de leche de vacas con lactancias prolongadas (15 a 40 Meses)

JESSICA MARIA FLORES SALAS (2015)

"Estudio epidemiológico de los factores de riesgo para lactancias prolongadas involuntarias (15 a 40 meses) utilizando una regresión logística de múltiples variables se llevo a cabo en 3278 vacas lecheras Holstein de alto rendimiento en un rebaño administrado de forma intensiva, ordeñadas tres veces al día en el norte de México. Los objetivos fueron evaluar la asociación de la duración de la lactancia (15 a 40 meses) con la producción de leche y cuantificar el efecto de múltiples servicios (4 a ≥ 14) en la preñez por inseminación artificial. Además, se realizó un análisis de supervivencia, utilizando el modelo de Cox, para probar como la ocurrencia de la preñez afecta la duración de la lactancia. La Retención de placenta (Índice de riesgo (IR) = 1.3), metritis (IR = 1.8), cetosis (IR = 1.4), pico de producción (<50 vs >50 kg, IR = 1.4 ), índice de temperatura humedad a los 60 días postparto (<82 vs >82 unidades, IR = 1.4), cetosis (IR = 1.4) y producción de leche de 305 días (<11,000 vs >11,000 kg, IR = 1.6) aumentó significativamente el riesgo de lactaciones > 15 meses. Las vacas primíparas mostraron menos de la mitad el riesgo de lactancias prolongadas (450 a 1,349 días en leche, máxima producción de leche 37,852 kg; r= 0.71) y comparado con las pluriparas (450 a 1,221 días en leche, máxima producción de leche 38,021 kg; r= 0.75). La preñez por inseminación artificial (P/IA) en vacas con lactancia prolongada disminuyó linealmente a medida que el número de servicios aumentó (P/IA 50.5 % por cuatro servicios y 12.8 % por ≥ 14 servicios). Los datos mostraron que las vacas Holstein altas productoras de manera intensive y ordeñadas tres veces al día fueron capaces de mantener vii lactancias de hasta 40 meses con notable persistencia de leche hasta el momento del secado. Además, este estudio coincide con los hallazgos previos que indican que los trastornos reproductivos y metabólicos derivados de parto son factores de riesgo importantes para lactancias prolongadas, derivado de la relación de las enfermedades periparturientas con la reproducción deprimida en las vacas lecheras."

"An epidemiological study of risk factors for involuntary extended lactations (15 to 40 months) using a multiple variable logistic regression was carried out on 3278 high-yielding dairy cows in an intensive well-managed Holstein herd, milked three times daily in northern Mexico. Additional objectives were to assess the association of lactation length (15 to 40 months) with milk yield and to assess the effect of multiple services (4 to ≥ 14) on pregnancy per artificial insemination. Also, a survival analysis was performed using the Cox proportional hazards model to test how the occurrence of pregnancy affect lactation length. Retained placenta (odds ratio (OR) = 1.3), metritis (OR = 1.8), ketosis (OR = 1.4), peak milk yield (<50 vs >50 kg, OR=1.4), temperature-humidity index at 60 days postpartum (<82 vs >82 units, OR = 1.4), ketosis (OR = 1.4) and 305-d milk yield (<11,000 vs >11,000 kg, OR = 1.6) significantly increased the risk for lactations >15 months. Primiparous cows had less than half the risk of extended lactations (OR = 0.3) compared to multiparous cows. Once a cow had conceived, her risk of having a prolonged lactation dropped sharply (P<0.01). A strong linear association was found between lactation length and total milk yield for primiparous (450 to 1349 days in milk, maximum milk yield 37,852 kg; r= 0.71) and pluriparous (450 to 1221 days in milk, maximum milk yield 38,021 kg; r= 0.75). Pregnancy per artificial insemination (P/AI) in cows with extended ix lactation dropped linearly as number of services increased (P/AI = 50.5% for 4 services and 12.8% for ≥ 14 services). The data showed that well-managed Holstein cows milked three times daily were capable of lactating up to 40 months with remarkable high persistency and with high milk yield at drying-off. Additionally, this study reinforces previous findings indicating that reproductive and metabolic disorders derived from calving are important risk factors for extended lactations, derived from the link of periparturient diseases with depressed reproduction in dairy cows."

Master thesis

Lactación prolongada Vacas Holstein CIENCIAS AGROPECUARIAS Y BIOTECNOLOGÍA

The application of inclusive design approach in the conceptual design of mechatronic products and reconfigurable manufacturing systems

ARTURO MOLINA GUTIERREZ (2004)

In the current rapidly ageing world, there is no commercial or social sense to design, develop or attempt to market products and services whose usability is unnecessarily, challenging to people, whether they be young or old, able-bodied or less able. There is the need to design and develop products with some functional capabilities that fulfill the needs of the widest possible population. This thesis is a research of how the inclusive design concepts can be applied and integrated in the process of product planning and its conceptual design. The methodology consists of a series of methods, considerations and activities that must be undertaken to perform a good design focusing on disabled people with the help of useful tools of the inclusive design. In addition, in this thesis is given a methodology for incorporating inclusive design concepts in reconfigurable manufacturing systems to enhance their key characteristics with the focus on a user centered approach, considering fully able users. The methodology comprehends an evaluation system for a FMS and the proposal to improve the system oriented to users. This thesis represents the use of wireless sensor technology to improve the assistive characteristics of products in the first part of mechatronic product design; and the addition of automation characteristics to the reconfigurable manufacturing systems to improve the system features and provide a better customization to users. Two case studies are developed in this thesis; the first one is the conceptual design of three mechatronic products and their improved capabilities with inclusive design. Then, a second case study with the addition of inclusive design to a existing manufacturing cell to achieve reconfigurability and improve its characteristics with the inclusive design approach.

Maestro en Ciencias Especialidad en Sistemas de Manufactura

Master thesis

INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS TECNOLOGÍA INDUSTRIAL ORGANIZACIÓN DE LA PRODUCCIÓN

Estudios para la paz en Nuestramérica y su relación con el giro decolonial en las ciencias sociales

Eduardo Sandoval Forero (2020)

Artículo de discusión sobre los estudios para la paz en NuestrAmérica.

El propósito del artículo consiste en constituir una narrativa desde la perspectiva descolonizadora, que apuesta por superar las estructuras rígidas de un escenario caracterizado por el colonialismo/eurocentrismo, el cual van en contravía de los procesos de resistencia y liberación desde los territorios en disputa por otros mundos posibles, pacíficos y decoloniales en Nuestra América.

REVISTA INTERNACIONAL DE FILOSOFÍA Y TEORÍA SOCIAL

Article

Decolonialidad Estudios para la paz NuestrAmérica Sociología emergente CIENCIAS SOCIALES

Oxidative damage in lipids in the central nervous system and spleen in iron-deficient mice

Oxidative damage in lipids in the central nervous system and spleen in iron-deficient mice

ANABELLA MARTINEZ DOMINGUEZ IRAZU CONTRERAS YANEZ JOSE ANTONIO ESTRADA GUADARRAMA (2017)

Oxidative stress (OS) is considered a risk factor for neurodegenerative disorders. Iron concentrations have been related to OS; however, the effect of iron deficiency (ID) on the induction of OS in the central nervous system (CNS) is unknown. A murine model of chronic diet-induced ID using 2 month-old male BALB/c mice (6 specimen), was used to determine its role in OS induction. Lipid peroxidation was determined by measuring thiobarbituric acid-reactive species (TBARS) in the CNS, using the spleen for comparison. A decrease of peroxidation products in the CNS of the ID group (ID CNS), compared to controls fed on a regular diet, was found. The spleen showed a significant increase of lipid peroxidation in the ID group. Our results suggest that chronic ID may have differential effects on OS in the CNS and peripheral tissues. A decreased amount of reactive oxygen species in the basal state may be related to alterations on normal CNS metabolism and functions under chronic ID.

Article

Multidisciplinarias (Ciencias Sociales) Oxidative stress lipid peroxidation iron deficiency central nervous system spleen Multidisciplinarias (Ciencias Sociales) Oxidative stress lipid peroxidation iron deficiency central nervous system spleen CIENCIAS SOCIALES

Impacto de la tuberculosis sobre la producción de leche y eficiencia reproductiva de vacas holstein

DULCE SOFÍA RESÉNDIZ HERNÁNDEZ (2014)

"El objetivo del presente estudio fue averiguar si las vacas Holstein de un alto potencial de producción de leche con pruebas positivas de tuberculosis se ven afectadas en su producción de leche y el desempeño reproductivo. Se utilizó un diseño prospectivo con dos grupos de animales (positivos a prueba intradérmica a tuberculina) y testigo (vacas no reactivas a tuberculosis). Se utilizaron 1,044 vacas sanas y 105 vacas positivas a la prueba de tuberculina. Las vacas positivas a tuberculosis provenían de varios establos comerciales de la zona de La Laguna en el noreste de México. Vacas que daban una reacción positiva a la prueba intradérmica de tuberculina (inyección de 0.1 ml de un derivativo de proteína purificada de bovino of M. bovis AN5) eran transferidas de 8 su establo de origen a otro establo donde permanecían aisladas, junto con otras vacas reactoras. Vacas libre de esta enfermedad eran mantenidas en el mismo establo, pero totalmente aisladas de las vacas reactoras. La eficiencia reproductivas de las vacas reactoras a tuberculosis fue afectada; la preñéz por inseminación artificial fue inferior (P < 0.05) en las vacas reactoras en comparación con el grupo testigo (16.9 vs. 20.7). Las vacas positivas a tuberculosis requirieron 4.52 ± 2.94 servicios por preñez comparado con 4.34 ± 2.72 para las vacas del grupo testigo (P > 0.05). El intervalo entre el parto y la concepción fue similar entre las vacas reactoras (154 ± 78 días) y las vacas del grupo testigo (150 ± 77 días). Las vacas testigo tendieron (P = 0.08) a producir más leche que las vacas reactoras en lactancias de 305 días (10,684 ± 1,720 vs. 10,345 ± 1,736; 3 ordeñas por día, media ± DE), Los metabolitos sanguíneos indicativos de la condición nutricional de las vacas no difirieron entre grupos de vacas. Se concluyó que las vacas positivas a tuberculosis presentaron una reducción en la producción de leche de 4% y de 4.6 puntos porcentuales en la preñez por inseminación artificial, sin que se presentaran alteraciones en los indicadores sanguíneos del nivel de reservas de energía de las vacas."

No incluye

Master thesis

Tuberculosis Producción de Leche Vacas Holstein CIENCIAS AGROPECUARIAS Y BIOTECNOLOGÍA