Advanced search


Knowledge area




4 results, page 1 of 1

Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

BLANCA ESTELA CHAVEZ SANDOVAL (2015)

106 páginas. Doctorado en Ciencias e Ingeniería Ambientales.

El auge por la utilización de nanopartículas (NPs) de metales nobles en diversos campos, ha derivado en la síntesis inorgánica de NPs metálicas, sin embargo, las metodologías utilizadas para su obtención son generalmente costosas e involucran el uso de químicos peligrosos, es por ello que recientemente ha aumentado el desarrollo de alternativas sustentables y amigables con el ambiente. Sintetizar AuNPs biológicamente es un procedimiento simple, poco costoso y menos perjudicial para el ambiente. El uso de extractos de plantas para la síntesis de nanomateriales aún no se ha explorado completamente, sin embargo, representa una buena alternativa ya que además de las ventajas antes mencionadas se obtienen NPs estables de diferente tamaño y forma. En este trabajo se realizó la síntesis y caracterización de AuNPs, así como su funcionalización con sondas específicas de DNA de dos microorganismos de interés ambiental Achlya sp. y Escherichia coli (E. coli). Achlya sp. es un hongo que infecta peces en piscifactorías, acuarios y embalses naturales; E coli, es una bacteria patógena para los humanos y constituye una fuente de contaminación en alimentos y agua. La sonda o secuencia blanco diseñada para Achlya sp. es: 5’GCACCGGAAGTACAGACCAA3’ y para E.coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ Las AuNPs obtenidas por síntesis química y por síntesis biológica a partir de extractos de laurel, nopal, cebolla, pera y café, fueron funcionalizadas con DNA de Achlya sp. y E. coli y pueden ser utilizadas en el diseño y construcción de biosensores ambientales para detectar a los microorganismos antes mencionados, excepto las NPs de café a pH 9, ya que estas no mostraron mediante caracterización por UV-Vis, una buena funcionalización. Por otro lado, se propone que, para la síntesis biológica, el ácido málico puede estar actuando como agente reductor y el grupo amino como agente estabilizador. Los genosensores permiten monitorear, prevenir y corregir aspectos que causan desequilibrios ecológicos en ambientes acuáticos. Estos nuevos dispositivos analíticos proporcionan información de forma rápida, simple y de bajo costo, comparada con las técnicas de análisis convencionales.

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Doctoral thesis

Organic compounds--Synthesis. Transition metal catalysts. Nanostructured materials--Synthesis. Green chemistry. Síntesis orgánica. Catalizadores metálicos. QD262 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS PROCESOS QUÍMICOS

Complejos metálicos de aminoquinolin-carboxamidas. Síntesis y caracterización estructural

CLAUDIA ELISETH DZUL PECH (2019)

Los compuestos heterocíclicos juegan un papel importante en el diseño de nuevos compuestos estructurales para aplicaciones medicinales. Entre ellos, se encuentran la quinolina y sus derivados, debido a que presentan un amplio espectro de actividades biológicas. De forma particular, los aminoquinolin-derivados han presentado actividades biológicas antimaláricas y anticancer, entre otras. En el caso de los que presentan actividad biológica, al incorporar iones metálicos de transición, se potencia aún más dicha actividad, como se observó con el N-(2-aminoetil)-4-((2-aminoetil)amino)-7-cloroquinolin-2-carboxamida (L1) y sus conjugados con ferroceno, que potenció su actividad contra la línea celular de cáncer de mama. Asimismo, considerando que el ligante L1 es una molécula multifuncional, puede ser usado como precursor de nuevos compuestos de coordinación, debido a la presencia de sus átomos de nitrógeno de ambiente químico diferente, así como la del átomo de oxígeno del C=O, que, dependiendo de las condiciones de reacción, puede actuar desde mono hasta polidentado, incluso dependiendo de la cantidad de iones involucrados como mononuclear o polinuclear, como se demostró en este estudio, que el ligante L1 con iones de Mn2+, Co2+, Ni2+, Zn2+ y Cd2+ tiene la capacidad de coordinarlos, actuando de forma monodentada (Zn2+, Cd2+), a través del nitrógeno tipo piridínico, y bidentada (Mn2+, Co2+, Ni2+), cuando también el oxígeno del C=O se coordina al ión metálico. Además, L1 favorece la formación de compuestos polinucleares con el zinc(II) y manganeso(II), donde la estructura del compuesto tiene dos iones metálicos que reciben densidad electrónica de los nitrógenos piridínicos de dos moléculas de ligante y a la vez, un tercer ion metálico los puentea, a través de la coordinación de los átomos de nitrógeno de los grupos amino.

Master thesis

Complejos metálicos síntesis caracterización INGENIERÍA Y TECNOLOGÍA

Influencia del calentamiento local por láser en la distribución de esfuerzos residuales en pruebas de flexión de tres puntos para aceros AHSS

ALAN EDUARDO DIAZ MENDOZA (2020)

Se presenta el análisis de la influencia del calentamiento local por láser en la distribución de esfuerzos residuales en pruebas de flexión de tres puntos para un tipo de acero avanzado de alta resistencia (HSS), específicamente para el acero tipo TRIP 440Y. Durante el desarrollo del proyecto se realizaron pruebas de tensión a diferentes direcciones de rolado (0°,45°,90°) bajo la norma ASTM E8, esto para poder realizar la caracterización del material. Una vez obtenido los datos experimentales se procedió a realizar las simulaciones por el método de elemento finito, con elementos shell y sólidos; para la primera se utilizó un modelo de endurecimiento Hill_3R que corresponde al material 122 de Ls-Dyna y el criterio de cedencia Hill48-r, para el segundo se utilizó un modelo de endurecimiento Piecewise Linear Plasticity que corresponde al material 024 de Ls- Dyna y el criterio de cedencia isotrópico de Von mises. Para la validación de los resultados se realizó el diseño y fabricación del herramental, bajo la norma ASTM E290-97a, mediante la cual se realizaron las pruebas de flexión, y con la norma ISO 7438 se calcularon los parámetros para realizar las pruebas a los ángulos de 30°,45° y 60°. De la misma forma la influencia del ángulo de flexión en la recuperación elástica del material es analizada y discutida en este trabajo. Las probetas ya deformadas se sometieron al calentamiento local láser, para posterior realizar la medición de esfuerzos residuales mediante la técnica de ESPI. Por último, se presentan las comparaciones entre resultados obtenidos mediante simulaciones y experimentos.

Master thesis

CIS- Maestría en Ingeniería Mecánica INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS TECNOLOGÍA E INGENIERÍA MECÁNICAS Calentamiento por láser Esfuerzos residuales - Distribución Ensayo de flexión Modelado de material AHSS (Advanced High Strehght Steels - Aceros Avanzados de Alta Resistencia) ASTM E8 (Norma para Pruebas de Tracción de Materiales) FEM (Finite Element Method - Método de elemento finito) Modelos de endurecimiento ISO 7438 (Norma sobre Ensayo de Flexión de Materiales Metálicos) Técnica de ESPI (Electronic Speckle Pattern Interferometry – Interferometría de Patrones de Moteado Electrónico)

Efecto de la exposición aguda y subcrónica a nanopartículas de óxidos metálicos en el sistema antioxidante de células hepáticas

Effect of acute and subchronic exposure to metal oxide nanoparticles on the antioxidant system of liver cells

Jesús Alberto Geraldo León (2021)

El aumento en los escenarios de exposición de las cada vez más utilizadas nanopartículas de óxido de zinc (NPsZnO), ha despertado el interés por estudiar su posible efecto tóxico en la salud. Diversos estudios han reportado que uno de los principales mecanismos de toxicidad de las NPsZnO es el estrés oxidativo, inducido cuando la célula presenta una producción excesiva de especies de oxígeno altamente reactivas (ROS) y su capacidad antioxidante no es suficiente para contrarrestarlo. En este estudio se evaluó la alteración del sistema antioxidante de hepatocitos a la exposición aguda y subcrónica de las NPsZnO en dos diferentes presentaciones: en polvo (NPsZnOp) y suspensión (NPsZnOd). Las NPsZnO fueron caracterizadas mediante dispersión dinámica de luz (DLS), microscopía electrónica de transmisión (TEM) y espectrofotometría UV-VIS. Se evaluó la citotoxicidad de las NPsZnO mediante el ensayo MTT, así como también la producción de ROS y la actividad de las enzimas superóxido dismutasa (SOD) y catalasa (CAT) de los hepatocitos utilizando métodos fluorimétricos y colorimétricos. Los resultados mostraron que las NPsZnOp usadas presentaron un tamaño promedio de 82±22 nm y son más tóxicas para los hepatocitos que las NPsZnOd con un tamaño promedio de 47±11 nm. La toxicidad superior de las NPsZnOp se asoció con su mayor capacidad para inducir la sobreproducción de ROS y para inhibir la actividad SOD y CAT de los hepatocitos, que a su vez se relacionaron con la internalización de las NPsZnOp. En exposiciones agudas ambas NPs provocaron efectos tóxicos dependientes de la producción de ROS que fueron generados por los iones Zn2+ liberados en el medio de cultivo. Sin embargo, se presentó un efecto hormético a largo plazo en los hepatocitos expuestos a NPsZnOd que se relacionó con la elevada actividad antioxidante de las enzimas SOD y CAT presentada a las 48 h de exposición. Estos resultados demuestran la gran influencia que tiene la actividad antioxidante en el grado de citotoxicidad provocado por las NPs y como las respuestas celulares pueden cambiar aun cuando las NPs evaluadas tengan el mismo compuesto, pero diferente tamaño y presentación.

The increment of exposure scenarios of the widely used zinc oxide nanoparticles (NPsZnO) has sparked interest in the study on their possible toxic effect on health. Several studies have reported that one of the main toxicity mechanisms of NPsZnO is the oxidative stress, induced when the cell presents an excessive production of highly reactive oxygen species (ROS), and its antioxidant capacity is not sufficient to contend with. In this study, the alteration of the hepatocyte antioxidant system upon acute and subchronic exposure to NPsZnO in two different presentations: powder (NPsZnOp) and suspension (NPsZnOd) was evaluated. The NPsZnO were characterized by dynamic light scattering (DLS), transmission electron microscopy (TEM), and UV-VIS spectrophotometry. The cytotoxicity of NPsZnO was evaluated by MTT assay, ROS production, superoxide dismutase (SOD), and catalase (CAT) enzyme activity in hepatocytes using fluorimetric and colorimetric methods were also evaluated. The results obtained herein showed that NPsZnOp have an average size of 82±22 nm and they are more toxic to hepatocytes than the NPsZnOd showing 47±11 nm in average size. The higher toxicity of NPsZnOp was associated with its ability to induce ROS overproduction and inhibit hepatocyte SOD and CAT enzymatic activities, which were linked to the internalization of NPsZnOp. In acute exposure scenarios, both NPs elicited toxic effects on hepatocytes by the ROS overproduction generated by the Zn2+ ions released in the culture medium. However, a long-term hormetic effect was presented in hepatocytes exposed to NPsZnOd related to the increased antioxidant activity of SOD and CAT enzymes presented at 48 h of exposure. These results demonstrate the significant influence of antioxidant activity on cytotoxicity triggered by NPs from the same chemical composition but different size and commercial presentation.

Master thesis

nanotoxicología, nanotoxicidad, nanopartículas de óxidos metálicos, hepatocitos, exposiciónaguda, exposición sub-crónica, estrés oxidativo, actividad antioxidante nanotoxicology, nanotoxicity, metal oxide nanoparticles, hepatocytes, acute exposure, sub-chronic exposure, oxidative stress, antioxidant activity INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS TECNOLOGÍA DE MATERIALES RESISTENCIA DE MATERIALES RESISTENCIA DE MATERIALES