Title

Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

Author

BLANCA ESTELA CHAVEZ SANDOVAL

Contributor

María Teresa Castañeda Briones (Thesis Adviser)

Access level

Open Access

Summary or description

106 páginas. Doctorado en Ciencias e Ingeniería Ambientales.

El auge por la utilización de nanopartículas (NPs) de metales nobles en diversos campos, ha derivado en la síntesis inorgánica de NPs metálicas, sin embargo, las metodologías utilizadas para su obtención son generalmente costosas e involucran el uso de químicos peligrosos, es por ello que recientemente ha aumentado el desarrollo de alternativas sustentables y amigables con el ambiente. Sintetizar AuNPs biológicamente es un procedimiento simple, poco costoso y menos perjudicial para el ambiente. El uso de extractos de plantas para la síntesis de nanomateriales aún no se ha explorado completamente, sin embargo, representa una buena alternativa ya que además de las ventajas antes mencionadas se obtienen NPs estables de diferente tamaño y forma. En este trabajo se realizó la síntesis y caracterización de AuNPs, así como su funcionalización con sondas específicas de DNA de dos microorganismos de interés ambiental Achlya sp. y Escherichia coli (E. coli). Achlya sp. es un hongo que infecta peces en piscifactorías, acuarios y embalses naturales; E coli, es una bacteria patógena para los humanos y constituye una fuente de contaminación en alimentos y agua. La sonda o secuencia blanco diseñada para Achlya sp. es: 5’GCACCGGAAGTACAGACCAA3’ y para E.coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ Las AuNPs obtenidas por síntesis química y por síntesis biológica a partir de extractos de laurel, nopal, cebolla, pera y café, fueron funcionalizadas con DNA de Achlya sp. y E. coli y pueden ser utilizadas en el diseño y construcción de biosensores ambientales para detectar a los microorganismos antes mencionados, excepto las NPs de café a pH 9, ya que estas no mostraron mediante caracterización por UV-Vis, una buena funcionalización. Por otro lado, se propone que, para la síntesis biológica, el ácido málico puede estar actuando como agente reductor y el grupo amino como agente estabilizador. Los genosensores permiten monitorear, prevenir y corregir aspectos que causan desequilibrios ecológicos en ambientes acuáticos. Estos nuevos dispositivos analíticos proporcionan información de forma rápida, simple y de bajo costo, comparada con las técnicas de análisis convencionales.

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Publisher

Universidad Autónoma Metropolitana (México). Unidad Azcapotzalco. Coordinación de Servicios de Información.

Publish date

June, 2015

Publication type

Doctoral thesis

Information Resource

Format

application/pdf

Language

Spanish

Source repository

Repositorio Institucional Zaloamati

Downloads

70

Comments



You need to sign in or sign up to comment.