Advanced search


Knowledge area




Filter by:

Publication type

Authors

Issue Years

Publishers

Origin repository

Access Level

Language

Subject

Select the topics of your interest and receive the hottest publications in your email

3 results, page 1 of 1

Síntesis de una membrana con líquido iónico de tercera generación, su evaluación en separación de CO2 y su captura en un cultivo hidropónico

CINTHIA ERIKA SANCHEZ FUENTES (2016)

101 páginas. Doctorado en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

En la presente investigación se sintetizaron cuatro membranas soportadas con líquidos iónicos (SILM) para evaluarlas en la separación de CO2 de la mezcla CO2/N2. Dos de ellos funcionalizados con un grupo amina en la parte catiónica, triflato de 1-(2-aminoetil)-3-metilimidazolio ([AEMIm]Tf) y tetrafluoroborato de 1-(2-aminoetil)-3-metilimidazolio ([AEMIm]BF4), el tercero posee el grupo amino en la parte aniónica, antranilato de trioctilmetilamonio ([TOMA]An) y el cuarto, el oleato de trietilmetilamonio ([TOMA]Ol). La estructura química de los líquidos iónicos se determinó por las espectroscopias de Resonancia Magnética Nuclear (NMR) y de Infrarrojo por Transformada de Fourier (FTIR), las propiedades térmicas se estudiaron con Análisis Termogravimétrico (TGA) y la densidad se determinó con un picnómetro. El nivel de impregnación y la distribución de los líquidos iónicos en el soporte tubular de alúmina se obtuvieron mediante Microscopía Electrónica de Barrido acoplado con Espectroscopia de Dispersión de Rayos X (SEM-EDX). Las propiedades de transporte de los gases se evaluaron por el método de volumen variable utilizando gases puros, a 30 °C y a 1, 2 y 3 bar, y mezcla de los mismos con una relación volumétrica de 50/50. La SILM [TOMA]An presentó el mayor valor para la selectividad con 70, además con esta membrana se obtuvo el mejor balance de perúselectividad superando los límites en la gráfica de Robeson. Las SILM con grupos amino reaccionaron con el CO2 para obtener el grupo químico carbamato. Los estudios de estabilidad térmica e infrarrojo sugieren que este grupo es estable aún después de haber iniciado el proceso de descomposición del líquido iónico. Para dar un valor agregado al uso del CO2, se enriqueció un invernadero de cultivo de lechuga hidropónico con este gas y se observó un efecto de aceleración del crecimiento.

In the present research work, four membranes supported with ionic liquids (SILMs) were synthesized to be evaluated in the CO2 separation from the CO2/N2 mixture. As for the ionic liquids, two of them were functionalized with an amino group at the cationic part, 1-(2-aminoethyl)-3-methylimidazolium triflate ([AEMIm]Tf) and 1-(2-aminoethyl)-3-methylimidazolium tetrafluoroborate ([AEMIm]BF4), the third and fourth ionic liquids possessed the amino group at the anionic part, trioctylmethylammonium anthranilate ([TOMA]An) and triethylmethylammonium oleate ([TOMA]Ol). The chemical structure of the ionic liquids was confirmed by nuclear magnetic resonance (NMR) and Fourier transform infrared (FTIR) spectroscopies; the thermal properties were studied by thermogravimetric analysis (TGA) and density was measured with a pycnometer. The impregnation degree and distribution of the ionic liquids in an alumina tubular support were established by means of scanning electron microscopy coupled with energy dispersive X-ray spectroscopy (SEM-EDX). The transport properties of the gases were evaluated by the variable volume method using pure gases and their mixtures with a 50/50 volumetric ratio at 30 °C and 1, 2 and 3 bar. The SILM [TOMA]An showed the highest selectivity (70) and the best permselectivity balance, surpassing the limits in the Robeson plot. The SILMs with amino groups reacted with CO2 to obtain the carbamate chemical group. The thermal stability and infrared studies suggest that this group is stable even after the beginning of the decomposition process of the ionic liquid. In order to provide an added value to the use of CO2, a lettuce hydroponic greenhouse was enriched with this gas, observing an accelerated growing effect.

Doctoral thesis

Ionic solutions. Membranes (Technology). Greenhouse gases--Environmental aspects. Soluciones iónicas. Membranas (Tecnología). QD543 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA DEL MEDIO AMBIENTE INGENIERÍA DE LA CONTAMINACIÓN

Construcción y caracterización de un cristal artificial elástico

FILIBERTO RAMIREZ RAMIREZ (2021)

In order to achieve the main objective, a design of a supercell or basic cell consisting of an array of elastic units will be made. This supercell will be obtained from a locally periodic structure of coupled blocks, whose central block will be deformed; later, the one-dimensional elastic artificial crystal will be built, which will be characterized experimentally and understood from a strong mooring model. The locally proposed system consists of a set of vibrating bars, identical, coupled together, imitating a set of " defectsin a one-dimensional periodic network and with a periodic coupling. It is expected that the acoustic wave amplitudes of this system show similar characteristics to the wave functions of an electron strongly linked in an eective potential generated by a one-dimensional network of atoms. In the locally periodic system that we propose the vibrating elastic units will be coupled together by means of locally periodic rods; since, in these we can control the resonance frequencies and the same frequency of normal resonance. Furthermore, in these rods, the lower energy vibration modes can be isolated from the rest of the excited states. When the resonance frequency of the elastic unit (defect) is in the gap of the coupler (locally periodic rod) the wave amplitude will be located. To generate the emergence of a new band in the second torsion spectrum gap, from an originally periodic system, using the transfer matrix method for torsional waves, six elastic structures formed by 1, 2, 3 and up to 6 were designed. coupled supercell The neighboring levels of the emerging band is separated to a maximum distance of 100 Hz to facilitate its detection. This band is in the frequency range of 26450 to 26650 kHz.

En esta tesis se estudia experimentalmente las vibraciones de sistemas formados por arreglos de unidades elásticas acopladas, que pueden ser descritas por un modelo de enlace fuerte. Después de haber probado diversos métodos de acoplamiento mecánico, entre dos unidades elásticas, en el sistema se eligió como el más adecuado un subsistema localmente periódico que sería utilizado como acoplador de las mismas, entre sí. Los distintos sistemas elásticos fabricados, bajo diseño específico, se caracterizan por el método de espectroscopia acústica resonante (ARS) y se comparan los resultados experimentales con los obtenidos usando un modelo de enlace fuerte. El objetivo de esta tesis es diseñar y caracterizar un cristal artificial elástico unidimensional con propiedades espectrales de un cristal atómico. Para ello se diseñó primero una supercelda o celda básica unitaria apropiada. Esta supercelda se obtuvo a partir de una estructura localmente periódica de celdas elásticas simples idénticas, uno de cuyos bloques se deforman en longitud, por lo que le denominamos el defecto dentro de la estructura periódica o impureza (ver gura 4.1). Mediante la deformación de la celda simple es posible aislar los modos de vibración de la banda de transmisión y forzarlos a aparecer dentro de las brechas que aparecen en el sistema periódico original (ver figura 3.2). Esto origina que la amplitud de onda torsional se localice dando lugar a una fenomenología análoga a la de los cristales atómicos que son descritos a través de un modelo de enlace fuerte. Habiendo conseguido un diseño que presenta las características adecuadas, tanto para la realización del modelo, como de la medición experimental se construye y se caracteriza experimentalmente.

Doctoral thesis

Crystals. Elasticity. Spectroscopy. Spectrum Analysis--methods. Cristales. QD933 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS TECNOLOGÍA DE MATERIALES

Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

BLANCA ESTELA CHAVEZ SANDOVAL (2015)

106 páginas. Doctorado en Ciencias e Ingeniería Ambientales.

El auge por la utilización de nanopartículas (NPs) de metales nobles en diversos campos, ha derivado en la síntesis inorgánica de NPs metálicas, sin embargo, las metodologías utilizadas para su obtención son generalmente costosas e involucran el uso de químicos peligrosos, es por ello que recientemente ha aumentado el desarrollo de alternativas sustentables y amigables con el ambiente. Sintetizar AuNPs biológicamente es un procedimiento simple, poco costoso y menos perjudicial para el ambiente. El uso de extractos de plantas para la síntesis de nanomateriales aún no se ha explorado completamente, sin embargo, representa una buena alternativa ya que además de las ventajas antes mencionadas se obtienen NPs estables de diferente tamaño y forma. En este trabajo se realizó la síntesis y caracterización de AuNPs, así como su funcionalización con sondas específicas de DNA de dos microorganismos de interés ambiental Achlya sp. y Escherichia coli (E. coli). Achlya sp. es un hongo que infecta peces en piscifactorías, acuarios y embalses naturales; E coli, es una bacteria patógena para los humanos y constituye una fuente de contaminación en alimentos y agua. La sonda o secuencia blanco diseñada para Achlya sp. es: 5’GCACCGGAAGTACAGACCAA3’ y para E.coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ Las AuNPs obtenidas por síntesis química y por síntesis biológica a partir de extractos de laurel, nopal, cebolla, pera y café, fueron funcionalizadas con DNA de Achlya sp. y E. coli y pueden ser utilizadas en el diseño y construcción de biosensores ambientales para detectar a los microorganismos antes mencionados, excepto las NPs de café a pH 9, ya que estas no mostraron mediante caracterización por UV-Vis, una buena funcionalización. Por otro lado, se propone que, para la síntesis biológica, el ácido málico puede estar actuando como agente reductor y el grupo amino como agente estabilizador. Los genosensores permiten monitorear, prevenir y corregir aspectos que causan desequilibrios ecológicos en ambientes acuáticos. Estos nuevos dispositivos analíticos proporcionan información de forma rápida, simple y de bajo costo, comparada con las técnicas de análisis convencionales.

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Doctoral thesis

Organic compounds--Synthesis. Transition metal catalysts. Nanostructured materials--Synthesis. Green chemistry. Síntesis orgánica. Catalizadores metálicos. QD262 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS PROCESOS QUÍMICOS