Advanced search


Knowledge area




9 results, page 1 of 1

Síntesis y caracterización de óxido de grafito funcionalizado con derivados y análogos de o-fenilendiamina. Obtención de bencimidazoles

MARIA VICTORIA BARRERA PASCUAL (2016)

128 páginas. Maestría en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

Los materiales a base de carbono han sido estudiados recientemente debido a sus potenciales propiedades y posibles aplicaciones en el campo de la física, química, electrónica y mecánica. Un derivado del grafito es el óxido de grafito el cual si bien fue descubierto hace más de un siglo ha despertado gran interés ya que no solo ha resultado ser un precursor de bajo costo para la obtención de grafeno a gran escala si no que los grupos oxigenados del óxido de grafito han permitido funcionalizarlo covalentemente en presencia de precursores que contienen nitrógeno tales como aminas orgánicas. La funcionalizacion covalente del óxido de grafito seguido de una reducción ha logrado ser una forma eficaz de modificar su estructura química y modular sus propiedades eléctricas. Pocas investigaciones se han centrado en el estudio del óxido de grafito funcionalizado no reducido, esto provoca el interés que se tiene por estudiar el proceso de funcionalizacion para lo cual se introdujeron una serie de compuestos orgánicos con grupos amino los cuales permitieron por medio de una reacción de ciclación la formación de bencimidazoles en la estructura del óxido de grafito. El presente trabajo tuvo como objetivo funcionalizar oxido de grafito con análogos y derivados de o-fenilendiamina previamente sintetizados además de servir como precursores para la obtención de bencimidazoles disubstituidos. La síntesis de derivados de o-fenilendiamina partió de o-nitroanilina y o-fenilendiamina con 2-cloropiridina y 2-cloropirimidina respectivamente. Las reacciones fueron efectuadas de manera convencional y asistida por horno de microondas, la caracterización de los productos se realizó por Resonancia Magnética Nuclear de 1H, 13C en equipo BRUKER de 400MHz con DMSOd6 como disolvente y espectroscopia de Infrarrojo por transformada de Fourier los cuales se realizaron en estado sólido en un equipo BRUKER FT-IR ALPHA en el modo de Reflectancia total atenuada. (ATR). Previo a la funcionalizacion el grafito fue oxidado por el Método de Hummers modificado tratándolo con KMnO4 y H2SO4, y posteriormente con H2O2. La funcionalizacion se realizó por ultrasonido con una dispersión de óxido de grafito en agua desionizada, posteriormente se adicionaron los compuestos orgánicos diluidos con etanol en presencia de ácido polifosforico como catalizador y la suspensión fue calentada por 24hrs. Se caracterizaron los materiales por las técnicas de Difracción de Rayos X, Análisis termogravimétrico, espectroscopia de Infrarrojo por transformada de Fourier, Raman y Microscopia Electrónica de Barrido con espectroscopia de energía dispersiva. Finalmente, se evaluó el rendimiento electroquímico de los materiales funcionalizados no reducidos utilizando la técnica de Voltamperometría Cíclica. Se impregno oxido de grafito con nafión en un electrodo de carbón vítreo utilizado como electrodo de trabajo, un alambre de platino como electrodo auxiliar y uno de plata como electrodo de referencia en una solución acuosa 1M de H2SO4 como electrolito. Los resultados de los óxidos de grafito funcionalizados indican valores de capacitancia especifica hasta ciento cincuenta veces mayores en comparación con el óxido de grafito no funcionalizado.

In recent years, carbon-based materials have been studied because of its potential properties and potential applications in the field of physics, chemistry, electronics and mechanics. A derivative of graphite is graphite oxide which although it was discovered over a century has aroused great interest since not only proved to be a precursor of low cost for obtaining graphene on a large scale if the oxygenated groups graphite oxide have allowed covalently funcionalizarlo in the presence of nitrogencontaining precursors such as organic amines. Covalent functionalization graphite oxide followed by reduction achieved be an effective way to modify their chemical structure and modulate its electrical properties. Few studies have focused on the study of oxide functionalized graphite unreduced, this causes the interest is to study the process of functionalization for which a number of organic compounds with amino groups which enabled by a reaction introduced cyclization formation benzimidazoles in the oxide structure of graphite. This work aims to functionalize graphite oxide analogs and derivatives o-phenylenediamine previously also serve as precursors for obtaining disubstituted benzimidazoles synthesized. Synthesis of o-phenylenediamine derivatives of o-nitroaniline left and o-phenylenediamine with 2-chloropyridine and 2-chloropyrimidine respectively. The reactions were carried out in conventional manner and microwave, characterization involved the determination of the melting points on a Fisher-Johns, Nuclear Magnetic Resonance 1H, 13C BRUKER 400MHz computer with DMSO-d6 as solvent and Infrared device transform Fourier which were performed in the solid state on a Bruker FT-IR ALPHA. Prior to functionalization graphite was oxidized by the method of treating the graphite Hummers modified with KMnO4 and H2SO4, and subsequently H2O2. Functionalization was carried sonicating oxide dispersion in deionized water graphite subsequently diluted organic compounds in small amounts of ethanol in the presence of polyphosphoric acid as catalyst and the suspension was heated for 24hrs were added. To better understand the process prior to functionalization reduction materials were characterized by the techniques of Fourier Transform Infrared, Raman, X-ray diffraction, thermogravimetric analysis and scanning electron microscopy. Finally electrochemical performance of the functionalized materials unreduced using Cyclic voltammetry technique is evaluated. graphite oxide with Nafion was impregnated in a glassy carbon electrode used as working electrode, a platinum wire as the auxiliary electrode and one silver as a reference electrode in a 1M aqueous H2SO4 solution as electrolyte. The results of oxides functionalized graphite indicate specific capacitance values up to fifty times greater in percent compared to graphite oxide unfunctionalized.

Other

Master Degree Work

Óxido de grafito, funcionalizacion covalente, fenilendiaminas N-sustituidas, bencimidazol, piridinas 2-sustituidas. Graphite oxide, covalent functionalization, benzimidazole, 2-substituted pyridines, phenylenediamines N-subst1. Carbon. Graphene--Oxidation. Benzimidazoles--Synthesis. Nanostructured materials. Carbono. Grafeno. Materiales nanoestructurados. TA455.C3 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS QUÍMICA DEL CARBONIO

Síntesis y evaluación de las propiedades mecánicas y de bioactividad de compositos de hidroxiapatita obtenida a partir de cascarón de huevo reforzada con biovidrio

ESTEFANIA GODOY COLIN (2019)

74 páginas. Maestría en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

En este trabajo se desarrollaron una serie de biomateriales compuestos (compositos) Hidroxiapatita-Biovidrio (HAp-BG) procesados por una técnica de polvos basada en la pulvimetalurgia y sinterizados a 800°C durante 1 h. La finalidad es evaluar el efecto de la adición de partículas de biovidrio en bajas concentraciones (3, 5, 10 y 15%wt) sobre las propiedades físicas, mecánicas, características microestructurales y de bioactividad de una matriz porosa de hidroxiapatita (HAp). La hidroxiapatita fue sintetizada por el método de precipitación a partir de precursores de calcio provenientes de cascaron de huevo y caracterizada por DRX, mientras que el biovidrio de tipo CaO-P2O5-SiO2 fue sintetizado por sol- gel y caracterizado por DRX y FTIR. Se realizaron estudios de caracterización microestructural (MO y MEB) y se determinaron parámetros de densidad, porosidad, microdureza y resistencia máxima a la compresión. Mientras que la bioactividad de los compositos HAp-BG fue evaluada in vitro con respecto a la capacidad de formación de apatita como resultado del contacto con la solución de fluido corporal simulado (SBF), la bioactividad fue caracterizada por técnicas de DRX, FTIR, MEB y X-EDS antes y después de la inmersión en la solución SBF.

Master thesis

Nanostructured materials. Biotechnology. Biomaterials. Materiales nanoestructurados. TP248.25.N35 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS ESTRUCTURA DE LAS MOLÉCULAS ORGÁNICAS

Síntesis y caracterización de nanopartículas de ZnO embebidas dentro de una matriz de SiO2 (SiO2/n-ZnONP/SiO2/p-Sisustrato) depositadas mediante sputtering reactivo

MARIO FRANCISCO AVILA MEZA (2019)

108 páginas. Doctorado en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

Se realizó el depósito de nano partículas de óxido de zinc, confinadas en una matriz de dióxido de silicio a partir de blancos de zinc y silicio puros, sobre sustratos de silicio tipo p, utilizando la técnica de erosión catódica reactiva asistida por radio frecuencia sin tratamiento térmico posterior al depósito de los materiales. Se llevó a cabo la caracterización morfológica, química, pruebas físicas y mediciones eléctricas de las estructuras obtenidas. Se logró obtener una capa de SiO2 con rugosidad en el rango de nanómetros, sobre sustratos de silicio, controlando la presión parcial de oxígeno durante el proceso de erosión catódica. Las cuencas, propias de la rugosidad del material obtenido (SiO2), sirvieron para alojar el Zn metálico promoviendo su nucleación y su oxidación parcial en un espacio reducido a la escala de nanómetros. Posteriormente se logró la oxidación completa del Zn y su confinamiento al depositar otra capa de SiO2, obteniendo muestras con la estructura: sustrato de silicio tipo p, óxido de silicio, nano partículas de óxido de zinc tipo n y una segunda capa de óxido de silicio: SiO2/n-ZnONP/SiO2/p-Sisustrato. Primero se analiza la morfología superficial de las muestras por medio de microscopías de fuerza atómica, de barrido y de transmisión. También se realizó difracción de rayos X, espectroscopía de luz visible y UV. Se demuestra la composición de dióxido de silicio de la primera capa depositada por medio de espectroscopía de infrarrojo. Se obtiene la presencia y distribución de partículas de Zn a través de espectroscopía por energías dispersadas de rayos X y por espectroscopía de masas de iones secundarios. Posteriormente se confirma la presencia del compuesto estequiométrico de ZnO por medio de espectroscopía de foto electrones emitidos por rayos X. Se confirma la presencia de partículas de ZnO con tamaño <10 nm con estructura cristalina hexagonal por medio de microscopía electrónica de transmisión. Finalmente, se demuestra el comportamiento rectificante, típico de una unión p-n, y su respuesta eléctrica a la luz por medio de mediciones corriente-voltaje, en régimen de iluminación y obscuridad. Se evidencía la variación de sus características eléctricas al estímulo de diferentes longitudes de onda por medio de la técnica de respuesta espectral.

The synthesis of zinc oxide nanoparticles, confined in a matrix of silicon dioxide from pure zinc and silicon targets, on a p-type silicon substrate was carried out. The technique of reactive cathodic erosion assisted by radio frequency without heat treatment after the deposit of the materials was used. The morphological, chemical, physical and electrical characterization of the structures obtained was carried out. It was possible to obtain a layer of SiO2 with roughness in the range of nanometers, on silicon substrates, controlling the partial pressure of oxygen during the process of cathodic erosion. The basins, typical of the roughness of the material obtained, served to house the metallic Zn, promoting its nucleation and its partial oxidation in a space reduced to the scale of nanometers. Subsequently, the complete oxidation of Zn and its confinement was achieved by depositing another layer of SiO2, obtaining samples with the structure: the p-type silicon substrate, a thin-roughness film of silicon oxide, n-type zinc oxide nanoparticles and finally a second layer of silicon oxide which completed the matrix; SiO2/n-ZnONP/SiO2/p-Sisustrate. First, the surface morphology of the samples is analyzed by atomic force, scanning and transmission microscopy, X-ray diffraction, and UV-visible light spectroscopy. The silicon dioxide composition of the first deposited layer is demonstrated by infrared spectroscopy. The presence and distribution of Zn particles were obtained through spectroscopy by scattered X-ray energies and by secondary ion mass spectroscopy. Subsequently, the presence of the stoichiometric ZnO compound is confirmed by X-ray photoelectric electron spectroscopy. The presence of ZnO particles with size <10 nm with hexagonal crystalline structure is evidenced by transmission electron microscopy. Finally, the rectifying behavior, typical of a p-n junction, and its electrical response to light by means of current-voltage, measurements in lighting and dark regime is demonstrated. The variation of its electrical characteristics to the stimulus of different wavelengths is evidenced by the spectral response technique.

Doctoral thesis

Nanostructured materials. Zinc oxide. Nanocrystals--Synthesis. Semiconductor nanocrystals. Materiales nanoestructurados. Óxido de cinc. Nanocristales semiconductores. TA418.9.N35 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS SÍNTESIS QUÍMICA

Structural modification of waste materials and its use in building materials

GONZALO MARTINEZ BARRERA GENCEL OSMAN (2015)

This chapter is divided into three sections, in the first one the modifications of waste materials by using gamma radiation are described; such materials are PET bottles, Tetra Pak packages and rubber tires. The second section describes the effects of these waste materials on the mechanical properties of concrete; and in the last section those effects provoked by gamma radiation in concrete containing these waste materials.

Book part

Waste materials Building materials Gamma radiation Mechanical properties INGENIERÍA Y TECNOLOGÍA

Identificación de terminales de motores trifásicos de 6, 9 y 12 puntas, diagrama de flujo modo automático

JOSE LUIS VIRAMONTES REYNA (2021)

Los empalmes ultrasónicos cable a cable en un arnés automotriz permiten enviar la misma señal eléctrica a diferentes módulos, localizados en distintas ubicaciones dentro del vehículo. La prueba de resistencia a la tracción es de las principales para evaluar el desempeño del empalme. El estudio se enfoca en determinar una relación analítica para estimar la fuerza de tracción que resistirá el empalme en base al área transversal de los cables que lo integran, para permitir a los arquitectos eléctricos comparar la fuerza de tracción estimada que resistirá el empalme, con la fuerza mínima requerida por la normatividad vigente, proporcionando una herramienta adicional para prevenir fallas en los vehículos provocadas por empalmes fracturados desde etapas tempranas del diseño del arnés. En conjunto con la relación analítica obtenida, también se obtiene una relación por regresión basada en los datos experimentales de las pruebas. Por último, se estima la fuerza de tensión de 21 empalmes con las dos relaciones logrando un error menor o igual al 10% con relación de la fuerza obtenida experimentalmente.

Wire to wire ultrasonic splices in an automotive harness enable to send the same electrical signal to different modules, located in different positions within the vehicle. The tensile strength test is one of the main trials to evaluate the splice performance. The study focuses in establish an analytic relationship to estimate the traction force supported by the splice based in the cross sectional area of the wires that comprise it, allowing electrical architects compare the estimated tensile force that the splice will resist, with the minimum force required by current standard, providing an additional tool to prevent vehicle failures caused by fractured splices since early stages of harness design. Altogether with the obtained analytic relationship, also a regression relation is obtained based in the experimental data of the tests. Finally, the tensile force of 21 splices is estimated with both relationships achieving an error less or equal to 10% of the test tension force.

Master thesis

Empalme ultrasónico Fuerza Tracción Materials resistance Ultrasonic splice Force Traction INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS TECNOLOGÍA DE MATERIALES RESISTENCIA DE MATERIALES RESISTENCIA DE MATERIALES

Hidroxisales laminares como materiales para la encapsulación de moléculas biológicamente activas y su posterior liberación modulada

PAULINA ALEJANDRA MONTAÑO GONZALEZ (2019)

138 páginas. Maestría en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

En el presente trabajo se describe la estrategia de síntesis de materiales híbridos mediante la asociación de una matriz inorgánica y una molécula biológicamente activa. Los materiales

sintetizados fueron evaluados como sistemas de liberación modulada de la molécula

biológicamente activa. La matriz inorgánica consiste en una hidroxisal laminar de MgZn o FeZn y se utilizó para la encapsulación de ácido nalidíxico o ácido pipemídico, quinolonas de primera generación con actividad biológica contra bacterias Gram-negativas, así como algunas bacterias Gram-positivas. Los materiales híbridos así obtenidos fueron protegidos por un recubrimiento ácidorresistente, consistente de alginato de sodio. La eficacia del sistema recubierto fue evaluada en la liberación modulada de la molécula biológicamente activa a condiciones de temperatura y pH controlados. La caracterización de los materiales se llevó a cabo mediante difracción de rayos-X, análisis termogravimétrico, espectroscopia de infrarrojo por transformada de Fourier, microscopía electrónica de barrido y espectroscopia de dispersión de energía. Por otro lado, las pruebas de evaluación para el seguimiento de la liberación de las moléculas biológicamente activas se realizaron mediante un espectrofotómetro de ultravioleta visible utilizando membranas de diálisis con tamaño de poro de 1 k Da en agua destilada y en agua de peptona tamponada; en medios sintéticos de jugo gástrico biliar y en fluidos sintéticos del intestino delgado. Finalmente, se evaluó la actividad y sensibilidad bactericida de aquellos materiales asociados a las moléculas biológicamente activas. Adicionalmente algunas de las hidroxisales dobles laminares se caracterizaron mediante espectroscopia fotoelectrónica de rayos-X. Se realizó un análisis complementario de evaluación para la determinación cuantitativa del contenido del ácido nalidíxico en una de las hidroxisales de FeZn mediante un disolutor y se caracterizó por cromatografía líquida de alta eficiencia. Estos resultados se muestran en el apéndice B.

Master thesis

Laminated materials. Composite materials. Materiales compuestos. Materiales laminados. TA418.9.L3 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS TECNOLOGÍA DE LA CATÁLISIS

Application of self-healing materials in architecture and construction industry: an exploratory review

SILVERIO HERNANDEZ MORENO JOSE LUIS TORRES QUINTANA DULCE GUADALUPE OCAMPO LUGO (2020)

ARTÍCULO ESPECIALIZADO EN REVISTA INTERNACIONAL INDEXADA

This work’s aim was to perform a review of the scientific literature from the standpoint of both the architect and builder. In the first place, on which self-healing materials are currently available for construction industry; secondly, to acknowledge the main applications and the self-healing methods of each material. The review was largely carried out using the scientific database tool sciencedirect® and other similar tools on the main applications of self-healing materials in construction industry. The results reveal that the main applications refer to the production of self-healing concretes and mortars by means of self-healing techniques, for example: insertion of microcapsules with various self-healing agents, followed by self-healing bacteria. It is concluded that with the use of these materials not only does the service life of structures of buildings improves, but also that of the entire building, increasing durability and noticeably decreasing maintenance and reparation costs.

Article

Smart materials Self-healing Construction materials HUMANIDADES Y CIENCIAS DE LA CONDUCTA

Síntesis y caracterización de nanopartículas de oro y su funcionalización con sondas específicas de DNA de Achlya sp. y Escherichia coli

BLANCA ESTELA CHAVEZ SANDOVAL (2015)

106 páginas. Doctorado en Ciencias e Ingeniería Ambientales.

El auge por la utilización de nanopartículas (NPs) de metales nobles en diversos campos, ha derivado en la síntesis inorgánica de NPs metálicas, sin embargo, las metodologías utilizadas para su obtención son generalmente costosas e involucran el uso de químicos peligrosos, es por ello que recientemente ha aumentado el desarrollo de alternativas sustentables y amigables con el ambiente. Sintetizar AuNPs biológicamente es un procedimiento simple, poco costoso y menos perjudicial para el ambiente. El uso de extractos de plantas para la síntesis de nanomateriales aún no se ha explorado completamente, sin embargo, representa una buena alternativa ya que además de las ventajas antes mencionadas se obtienen NPs estables de diferente tamaño y forma. En este trabajo se realizó la síntesis y caracterización de AuNPs, así como su funcionalización con sondas específicas de DNA de dos microorganismos de interés ambiental Achlya sp. y Escherichia coli (E. coli). Achlya sp. es un hongo que infecta peces en piscifactorías, acuarios y embalses naturales; E coli, es una bacteria patógena para los humanos y constituye una fuente de contaminación en alimentos y agua. La sonda o secuencia blanco diseñada para Achlya sp. es: 5’GCACCGGAAGTACAGACCAA3’ y para E.coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ Las AuNPs obtenidas por síntesis química y por síntesis biológica a partir de extractos de laurel, nopal, cebolla, pera y café, fueron funcionalizadas con DNA de Achlya sp. y E. coli y pueden ser utilizadas en el diseño y construcción de biosensores ambientales para detectar a los microorganismos antes mencionados, excepto las NPs de café a pH 9, ya que estas no mostraron mediante caracterización por UV-Vis, una buena funcionalización. Por otro lado, se propone que, para la síntesis biológica, el ácido málico puede estar actuando como agente reductor y el grupo amino como agente estabilizador. Los genosensores permiten monitorear, prevenir y corregir aspectos que causan desequilibrios ecológicos en ambientes acuáticos. Estos nuevos dispositivos analíticos proporcionan información de forma rápida, simple y de bajo costo, comparada con las técnicas de análisis convencionales.

The pick in the use of noble metal nanoparticles (NPs) in various fields has resulted in inorganic synthesis of metal NPs, however the methodologies used for their preparation are generally expensive and involve the use of hazardous chemicals, is why has recently increased the development of sustainable and environmentally friendly alternatives. Synthesize biologically AuNPs is easy, inexpensive and is less damaging to the environment. The use of plant extracts for the synthesis of nanomaterials has not yet been fully explored, however represents a good alternative as well as the aforementioned advantages are obtained stable NPs of different size and shape. In this work the synthesis and characterization of AuNPs wasnperformed, and their functionalization with specific DNA probes of two microorganisms of environmental interest Achlya sp. and Escherichia coli (E. coli). Achlya sp. is a fungus that infects fish farms, aquariums and natural reservoirs; E coli is a bacteria pathogenic to humans and is a source of contamination in food and water. The DNA probe or target sequence designed to Achlya sp. is: 5’ GCACCGGAAGTACAGACCAA 3’ and E. coli: 5’TTGCTTTGGCAAGTCCTCCT 3’ The AuNPs obtained by chemical synthesis and biological synthesis extracts from laurel, nopal, onion, pear and coffee were functionalized with DNA Achlya sp. and E. coli and can be used in the design and construction of biosensors for detecting environmental microorganisms before mentioned, except NPs coffee at pH 9, as these do not show a good functionalization. Furthermore it is proposed that for the biological synthesis, malic acid may be acting as a reducing agent and the amino group as a stabilizing agent. Finally, the genosensors allow monitoring, preventing and correcting issues that cause ecological imbalances in aquatic environments. These new analytical devices provide information quickly, simple and inexpensive compared with conventional analysis techniques.

Doctoral thesis

Organic compounds--Synthesis. Transition metal catalysts. Nanostructured materials--Synthesis. Green chemistry. Síntesis orgánica. Catalizadores metálicos. QD262 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS PROCESOS QUÍMICOS

ZIF’s como soporte catalítico y fuente primaria de carbono en la síntesis de materiales nanoestructurados de carbono y su aplicación en el almacenamiento de hidrógeno

MARIA JOSE MARTIN MARTINEZ (2020)

113 páginas. Maestría en Ciencias e Ingeniería de Materiales.

Investigación realizada con el apoyo del Consejo Nacional de Ciencia y Tecnología (México). CONACYT.

En la actualidad, el uso desmedido de los combustibles fósiles, debido al crecimiento de la población, ha provocado problemas ambientales severos, como lo es el calentamiento global. Por ello, la búsqueda de nuevos combustibles limpios como el metanol e hidrógeno ha tenido un gran crecimiento, principalmente en el almacenamiento de este último. En el presente trabajo se planteó la síntesis verde de diferentes materiales ZIFs (ZIF-67, basados en Co y Ni); estos materiales, debido a sus propiedades, son competentes para el almacenamiento de hidrógeno y, además, como catalizadores en la síntesis de nanotubos de carbono. Se estudiaron tres tipos de síntesis verdes, con la finalidad de disminuir los contaminantes que se pueden generar en el proceso; el método hidrotermal, método ionotermal (usando un solvente eutéctico profundo) y el método mecanoquímico (solamente el método hidrotermal está reportado en la literatura para la síntesis de este material). Posteriormente, a estos materiales sintetizados se les realizaron pruebas para evaluar su eficiencia en el almacenamiento de hidrógeno. Por último, los ZIFs sintetizados se emplearon en el crecimiento de nanotubos de carbono por el método CVD, donde estos ZIFs se usaron como una fuente primaria de carbono. Finalmente, todos los materiales sintetizados (ZIFs y NTCs) fueron caracterizados por diferentes técnicas analíticas tales como: Difracción de rayos-X, espectroscopia FT-IR, espectroscopia Raman, microscopia electrónica de barrido, espectroscopia de rayos-X dispersivos y por fisisorción de nitrógeno. Para el caso del almacenamiento de hidrógeno los ZIF-67(Co) sintetizados por los métodos hidrotermal e ionotermal obtuvieron los mejores resultados (4.74% y 3.04%, respectivamente).

Master thesis

Nanoparticles--Environmental aspects. Nanostructured materials--Synthesis. Nanochemistry. Green chemistry. Química verde. Materiales nanoestructurados. Nanotubos. TA418.9.N35 INGENIERÍA Y TECNOLOGÍA CIENCIAS TECNOLÓGICAS INGENIERÍA Y TECNOLOGÍA QUÍMICAS TECNOLOGÍA DE LA CATÁLISIS