Author: Hugo Mendieta Zerón

Intracellular signaling pathways involved in childhood acute lymphoblastic leukemia; molecular targets

CRISTIAN FABIAN LAYTON TOVAR Hugo Mendieta Zerón (2016)

Acute lymphoblastic leukemia (ALL) is a malignant disease characterized by an uncontrolled proliferation of immature lymphoid cells. ALL is the most common hematologic malignancy in early childhood, and it reaches peak incidence between the ages of 2 and 3 years. The prognosis of ALL is associated with aberrant gene expression, in addition to the presence of numerical or structural chromosomal alterations, age, race, and immunophenotype. The Relapse rate with regard to pharmacological treatment rises in childhood; thus, the expression of biomarkers associated with the activation of cell signaling pathways is crucial to establish the disease prognosis. Intracellular pathways involved in ALL are diverse, including Janus kinase/Signal transducers and transcription activators (JAK-STAT), Phosphoinositide-3- kinase–protein kinase B (PI3K-AKT), Ras mitogen-activated protein kinase (Ras-MAPK), Glycogen synthase kinase-3b (GSK-3b), Nuclear factor-kappa beta (NF-jB), and Hypoxia-inducible transcription factor 1a (HIF-1a), among others. In this review, we present several therapeutic targets, intracellular pathways, and molecular markers that are being studied extensively at present.

Article

Acute lymphoblastic leukemia Biological markers Signaling pathways Targets Therapeutic MEDICINA Y CIENCIAS DE LA SALUD

Low T3 syndrome as cause of obesity

Daniela González Esquivel Hugo Mendieta Zerón (2020)

It is well-known that hypothyroidism predisposes to weight gain and obesity, but in the synthesis process of the thyroid hormones there are several steps that can fail producing the same consequence. In this respect, almost all studies talk about the decrease in T3 levels in cases of hospitalization but none as the primary cause of obesity. Here we report a case of chronic obesity since childhood with persistent low T3 values, high deiodinase (DIO)-2 and normal reverse T3, thus proposing that low T3 syndrome is not only the result of a critical condition but could be previous to any acute disease leading to weight gain and obesity.

Article

Low thyroid hormone syndrome Obesity MEDICINA Y CIENCIAS DE LA SALUD

A Simple Mathematical Model for Wound Closure Evaluation

ALEJANDRA VIDAL Hugo Mendieta Zerón Israel Giacaman (2016)

The incidence of ulcers associated to type 2 diabetes mellitus (T2DM) increases every year. We introduce and explore a new mathematical algorithm to evaluate wound-healing in foot ulcers associated to T2DM. Fifteen patients (nine women and six men), mean age of 70 6 16 years were included. The evolution of their wounds followed-up for a period of 18–45 days. According to the Wagner grading system the ulcers were grade I (5 patients), grade II (9 patients), and grade III (1 patient). Clinically, the type of the ulcers was neuroischemic (12 patients) and neuropathic (3 patients). A new parameter is introduced, the ‘‘continuous linear healing rate’’ Dc that was more accurate with higher values and requires less quantifications than usual formulas to make a wound-healing projection.

This research has been supported by FONDECYT Regular 1150899, the Programa Semilla, Universidad Autónoma del Estado de México-Universidad Austral debChile, grant numbers 3338/2012 FS, and FS-2012-01, and the Regional Government of Los Ríos, Chile, grant numbers FIC-R 2011 and 12-117.

Article

Mathematical Model Wound Closure Evaluation MEDICINA Y CIENCIAS DE LA SALUD

Familial autoimmune thyroid disease and PTPN-22

GABRIEL CONZUELO RODRIGUEZ Hugo Mendieta Zerón (2015)

Aim Autoimmune thyroid disease (AITD) is a multifactorial disease with a genetic predisposition. The protein tyrosine phosphatase-22 (PTPN-22) gene is a powerful inhibitor of T-cell activation. The aim of this study was to compare messenger RNA (mRNA) PTPN22 expression between healthy persons and patients with hypothyroidism and with their affected relatives. Methods This was a cross-sectional, prospective and descriptive study. DNA was extracted from leukocytes (4,000-10,000 cells) using the Magna Pure LC 2.0 Instrument and MagNA Pure LC RNA Isolation Kit I (Roche, Germany). A real-time polymerase reaction (qPCR) was performed utilizing the primer sets specific for the PTPN-22 gene, and the succinate dehydrogenase complex, the subunit A, Flavoprotein (Fp) (SDHA) constitutive gene. All reactions were performed with the 7500 Fast Real Time PCR System (Applied Biosystems, Applera International, Inc. Cheshire, UK) employing the SYBR Advantage qPCR Premix Kit (Clontech, USA). Results Twenty five patients with AITD (hypothyroidism), all females (mean age 39.6 ± 11.8 years) and 23 control subjects (mean age 24.4 ± 4.2 years) were included in the study. There was no statistical difference between both groups in PTPN-22 mRNA expression (p = 0.125). Conclusion There is no clear difference in mRNA PTPN-22 expression. The ideal genes for a systematic screening for familial AITD are yet to be found.

This work was partially funded by Ciprés Grupo Médico (CGM).

Article

Genetic screening Hypothyroidism qPCR MEDICINA Y CIENCIAS DE LA SALUD

Degree of Control and Main Complications of Hyperthyroid Pregnant Women in a Real Life Experience with Methimazol

Diana Diaz Arizmendi Hugo Mendieta Zerón (2020)

Hyperthyroidism is one of the main endocrinopathies during pregnancy. The aim of this project was to identify the degree of control of hyperthyroid pregnant women based on the recommendations of the American Thyroid Association (ATA) in a real situation without the availability of propylthiouracil. This was a descriptive, retrospective and longitudinal study, including medical files of pregnant women with hyperthyroidism between 18 and 35 years. They were classified as having "Adequate" control if their thyroid profiles were within the recommendations of the ATA and had no adrenergic symptoms; and were categorized as having "Inadequate" control if they were not stabilized with monotherapy, or if they required high doses of antithyroid drugs or beta-blockers or showed serious complications including the need of an Intensive Care Unit (ICU) for mothers or neonates. The Chi square test was performed between treatment groups during the third trimester and the complications of pregnant women or neonates. A total of 173 hyperthyroid pregnant women were studied with an average age of 21 ± 4.7 years. Of the 33 patients with hyperthyroidism who received monotherapy with methimazole until the end of pregnancy, 23 (69.69%) were classified as having "Adequate" control. In a real life situation there is delay in the diagnosis of hyperthyroidism during pregnancy but even without propylthiuracil, an “Adequate” control can be reached in up to 20.53% of cases based on a methimazole monotherapy.

Article

Complications Control Hyperthyroidism Pregnancy Methimazol MEDICINA Y CIENCIAS DE LA SALUD

NF-κΒ and SOD expression in preeclamptic placentas

ABRAHAM SILVA CARMONA Hugo Mendieta Zerón (2016)

Background/aim: Preeclampsia is a leading cause of maternal death in the developing world. Our aim was to quantify and compare messenger (mRNA) expression of nuclear factor-kappa beta (NF-κΒ) and superoxide dismutase (SOD) in control patients with preeclampsia and without preeclampsia with or without familial hereditary background. Materials and methods: Four groups of patients were formed depending on the presence or absence of preeclampsia and presence or absence of familial history for preeclampsia. NF-κΒ and SOD were measured in human placentas by real-time quantitative polymerase chain reaction. The 2–ΔΔct analysis method was used to measure the difference in the relative expression of the target genes in each group of patients. Results: In NF-κΒ expression, there was an increase of 23.35% in the group of women with preeclampsia versus women with preeclampsia without familial history. Regarding SOD, there was a reduction of about 33.33% in the expression in women with preeclampsia with familial history versus women with preeclampsia without familial history. Conclusion: Familial presence of preeclampsia could predispose to altered expression in SOD and NF-κΒ.

This project was partially funded by PROMEP/103.5/09/7342, Secretaría de Educación Pública, Mexico, and the Asociación Científica Latina (ASCILA).

Article

Genetic background Preeclampsia Nuclear factor-kappa beta Superoxide dismutase MEDICINA Y CIENCIAS DE LA SALUD

Renal evaluation in patients with type 2 diabetes mellitus and its association with diastolic blood pressure

Anna Dotsenko Hugo Mendieta Zerón Martha Ruth Mendieta Alcántara (2016)

Background: HbA1c is correlated with the estimated glomerular filtration rate (eGFR) and diastolic blood pressure (DBP). Our main objective was to evaluate the trend of biochemical and clinical variables, in relation to the eGFR in patients with type 2 diabetes mellitus (T2DM). Methods: This was a retrospective, longitudinal, and descriptive study, including patients with T2DM, who were cared for from January 2014 until December 2014, at the Clínica de Diabetes, Hospital Regional “Gral. Ignacio Zaragoza", ISSSTE, Mexico City, Mexico. eGFR was calculated using three formulas: the chronic kidney disease –epidemiology collaboration (CKD-EPI), Cockcroft-Gault, and modification of diet in renal disease (MDRD), during two periods of observation, 3 and 6 months. The results were compared by Student t tests or Wilcoxon-Mann-Whitney test depending on the variable distribution. Pearson correlation was employed to determine the relation between the eGFR determined with each formula and the analyzed variables. Results: The mean age was 56.5±11.3 years in the group of 3 months’ follow-up (n=110) and 57.1±13.8 years in the group of 6 months’ follow-up (n=47). In both groups, the formula with the lowest percentages of cases of CKD was CKD-EPI and the difference of this formula had a basal and final significant positive correlation with the DBP. Conclusion: The CKD-EPI formula showed the lowest percentages of cases of CKD in a short follow-up period, and its difference is consistently associated with the DBP, confirming the importance of controlling the later to mitigate the evolution to CKD.

Article

Renal evaluation Type 2 diabetes mellitus Diastolic blood pressure MEDICINA Y CIENCIAS DE LA SALUD

Cetoacidosis por empagliflozina post histerectomía

Claudia González León Jorge Maciá Ubierna Hugo Mendieta Zerón (2020)

Paciente de sexo femenino de 42 años, con diagnóstico de diabetes mellitus tipo 2, de 3 años de evolución, era tratada con empagliflozina/metformina. Intervenida quirúrgicamente por miomatosis uterina, presentó en el postoperatorio inmediato deterioro neurológico y acidosis metabólica, sin hiperglicemia, pero con desequilibrio hidroelectrolítico. Fue ingresada a terapia intensiva, requiriendo manejo invasivo con hemodiálisis y diálisis peritoneal por acidosis refractaria. Egresó luego de 17 días de estancia intrahospitalaria, en buenas condiciones generales.

Article

Cetoacidosis refractaria Empagliflozina Miomatosis MEDICINA Y CIENCIAS DE LA SALUD

Mexican pregnant women show higher depression and anxiety with older ages and in case of being single

Irma Visoso Salgado Jayson Leonel Moncada Mendoza Hugo Mendieta Zerón (2019)

Background. Pregnancy is an important predisposition period to develop anxiety and depression, with a direct impact on the woman’s offspring. The aim of this study was to report the correlation between depression and anxiety in pregnant women and its association with the marital status and age. Materials. A descriptive, retrospective and cross-sectional study was conducted in the outpatient care of the Psychology Service at the “Mónica Pretelini Sáenz” Maternal Perinatal Hospital (HMPMPS), Toluca, Mexico, from June 2012 to March 2019. As routine, the Beck Depression Inventory (BDI-II) and the Beck Anxiety Inventory-Trait (BAIT), were applied to all women seeking attention at the HMPMPS. Only pregnant patients were selected for this study, with the women referred for the first time to the external Psychology Clinic as inclusion criteria. Pearson’s correlation coefficient and the frequency of cases for age, BDI-II, and BAIT were obtained using the IBM SPSS Statistics ® v.23 software. Results. The study included 2947 pregnant patients with a mean age of 28.6 ± 6.9 years. Of these, 2616 (88.8%) presented with mild anxiety, 269 (9.1%) with moderate, and 62 (2.1%) with severe anxiety. On the other hand, 2149 (72.9%) patients presented with minimal depression, 341 (11.6%) mild depression, 268 (9.1%) moderate depression, and 189 (6.4%) had severe depression. The correlations between age and BDI-II was –0.026 (P = 0.152), between age and BAI was –0.038 (P = 0.037), and between BAIT and BDI-II 0.650 (P ≤ 0.001). Conclusions. The age group with the highest frequency of depression and anxiety was from 20 to 29 years. The absence of a stable partner represented an important risk factor for anxiety and depression during pregnancy.

Article

Age Anxiety Depression Marital status Pregnancy Risk factors MEDICINA Y CIENCIAS DE LA SALUD

Body Mass Index in Pregnancy Does Not Affect Peroxisome Proliferator-activated Receptor Gamma Promoter Region (-359 to -260) Methylation in the Neonate

RUTH ELIZABETH CASAMADRID VAZQUEZ ARACELI AMAYA CHAVEZ Hugo Mendieta Zerón (2016)

Background: Obesity in pregnancy can contribute to epigenetic changes. Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferator‑activated receptor γ (PPAR) promoter region (−359 to − 260) in maternal and neonatal leukocytes. Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000–10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA Methylation‑Direct™ Kit; Zymo Research). Real‑time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARg coactivator (PPARG) M3 were 5’‑aagacggtttggtcgatc‑3’ (forward), and5’‑cgaaaaaaaatccgaaatttaa‑3’ (reverse) and those for PPARG unmethylated were: 5’‑gggaagatggtttggttgatt‑3’ (forward) and 5’‑ttccaaaaaaaaatccaaaatttaa‑3’ (reverse). Intergroup differences were calculated using the Mann–Whitney U‑test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.). Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (−359 to − 260). Conclusion: The PPARγ promoter region (−359 to − 260) in peripheral leukocytes is unlikely to get an obesity‑induced methylation in pregnancy.

Acknowledgments Authors thank the National Council of Science and Technology (CONACYT), México, for the MSc. Scholarship awarded to Ruth Elizabeth Casamadrid Vázquez and Maggie Brunner M.A., for her excellent help with the English style correction. Financial support and sponsorship National Council of Science and Technology (CONACYT), Mexico and Asociación Científica Latina A.C (ASCILA).

Article

Body mass index Methylation Peroxisome proliferator‑activated receptor gamma Pregnancy MEDICINA Y CIENCIAS DE LA SALUD