Author: ARACELI AMAYA CHAVEZ

Iron profile and hepcidin associated with oxidative stress and metabolic disturbances in pregnancy

Karla Mariana Ortega López ARACELI AMAYA CHAVEZ ARACELI AMAYA CHAVEZ Patricia Vieyra Reyes Hugo Mendieta Zerón (2020)

Background: A common problem during pregnancy is anemia and to reduce its prevalence the WHO and national guidelines recommend a prescription of 30 to 60 mg of iron/day. The aim of this study was to evaluate the association of iron profile, hepcidin and oxidative stress in pregnant women prescribed with iron as a probable cause of metabolic disorders. Method: In this cohort study two groups were followed: A) women with low-risk pregnancy (WLRP), B) women with high-risk pregnancy (WHRP): women with metabolic disorders (dyslipidemias, GDM and high blood pressure). Oxidative stress enzymes, iron profile and hepcidin were measured in the second and third trimesters. Results: There were significant differences in hepcidin levels between WLRP and WHRP in 2nd (3.6 ± 4.2 vs 4.69 ± 3.23 P=0.005) and 3rd trimester (3.65 ± 3.44 vs 6.84 ± 5.14 P=0.02). The serum iron concentration had a negative relationship with catalase (-0.599; P=0.04) and a positive relationship with glutathione peroxidase (0.729; P=0.007). Conclusion: The iron serum levels increase could induce oxidative damage in pregnancy. Increased hepcidin is a useful biomarker for determining iron availability in pregnancy and its association with antioxidant systems.

Article

Iron profile Hepcidin Oxidative stress Metabolic disturbances Pregnancy MEDICINA Y CIENCIAS DE LA SALUD

Body Mass Index in Pregnancy Does Not Affect Peroxisome Proliferator-activated Receptor Gamma Promoter Region (-359 to -260) Methylation in the Neonate

RUTH ELIZABETH CASAMADRID VAZQUEZ ARACELI AMAYA CHAVEZ Hugo Mendieta Zerón (2016)

Background: Obesity in pregnancy can contribute to epigenetic changes. Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferator‑activated receptor γ (PPAR) promoter region (−359 to − 260) in maternal and neonatal leukocytes. Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000–10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA Methylation‑Direct™ Kit; Zymo Research). Real‑time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARg coactivator (PPARG) M3 were 5’‑aagacggtttggtcgatc‑3’ (forward), and5’‑cgaaaaaaaatccgaaatttaa‑3’ (reverse) and those for PPARG unmethylated were: 5’‑gggaagatggtttggttgatt‑3’ (forward) and 5’‑ttccaaaaaaaaatccaaaatttaa‑3’ (reverse). Intergroup differences were calculated using the Mann–Whitney U‑test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.). Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (−359 to − 260). Conclusion: The PPARγ promoter region (−359 to − 260) in peripheral leukocytes is unlikely to get an obesity‑induced methylation in pregnancy.

Acknowledgments Authors thank the National Council of Science and Technology (CONACYT), México, for the MSc. Scholarship awarded to Ruth Elizabeth Casamadrid Vázquez and Maggie Brunner M.A., for her excellent help with the English style correction. Financial support and sponsorship National Council of Science and Technology (CONACYT), Mexico and Asociación Científica Latina A.C (ASCILA).

Article

Body mass index Methylation Peroxisome proliferator‑activated receptor gamma Pregnancy MEDICINA Y CIENCIAS DE LA SALUD

Phthalates in the diet of Mexican children of school age. Risk analysis

ARACELI AMAYA CHAVEZ MARIA MAGDALENA GARCIA FABILA JUAN CARLOS SANCHEZ MEZA ALICIA REYES GARCIA LILIA PATRICIA BUSTAMANTE MONTES (2020)

Artículo científico

Phthalates are widely used as plasticizers, additives, or solvents. Its extensive use has generated environmental and food contamination, which implies continuous population exposure. The aim of this work was to determine the probability of health risk of Mexican children exposed to phthalates through the consumption of contaminated food. A survey was applied to 384 Mexican school-age children (between 6 and 12 years old), to find out the type of food they eat most frequently, based on this, a research was made to know the concentration of phthalates contained in these foods. The daily intake had been calculated with the concentration of phthalates reported in food, obtaining: DEHP (19.50 μg/kg body weight/day), DnBP (5.52 μg/kg body weight/day) y for DEP (1.12 μg/kg body weight/day). The hazard index (HI) for DEP y DEHP was 0.49 to 42.5 for internal organs damage reported. HI for reproductive health damage due to exposure to DnBT and DEHP was of 0.04 to 5.58, so that there is a high probability that children’s health is at risk. Therefore, it is necessary to a quantitative analysis of phthalates in food consumed in Latin American countries and establish the TDI of phthalates especially, to DEHP, which was obtained the higher HI.

Universidad Autónoma del Estado de México

Article

Food exposure Diethyl phthalate Dibutyl phthalate Di-2 ethyl hexyl-phthalate Children’s Health hazard index BIOLOGÍA Y QUÍMICA

Aplicaciones electroquímicas al tratamiento de aguas residuales

Manuel Andrés Rodrigo Pablo Cañizares FRANCISCO JAVIER LLANOS HUESCA JUSTO LOBATO FABIOLA MARTINEZ RAMIREZ KAREN CRISTINA SAEZ GOMEZ ARTURO COLIN CRUZ Armando Diez Pérez LINA AGUSTINA BERNAL MARTINEZ THELMA BEATRIZ PAVON SILVA VICTOR FRANCISCO PACHECO SALAZAR BERNARDO ANTONIO FRONTANA URIBE RUBEN CESAR VASQUEZ MEDRANO FERNANDO FELIPE RIVERA ITURBE MARTIN ROGELIO CRUZ DIAZ ELIGIO PASTOR RIVERO MARTINEZ IGNACIO GONZALEZ MARTINEZ GABRIELA ROA MORALES IVONNE LINARES HERNANDEZ ARACELI AMAYA CHAVEZ CARLOS EDUARDO BARRERA DIAZ ANAID CANO QUIROZ RICARDO VICTORIA LEON SARAI VELAZQUEZ PEÑA VERONICA MARTINEZ MIRANDA Patricia Balderas Hernández JUAN MANUEL PERALTA HERNANDEZ MARCELA MENDEZ TOVAR ROBERTO ACERO RUEDA Ricardo Jaime Guerra Sánchez Enric Brillas VIOLETA LUGO LUGO Sergio Alejandro Martínez Delgadillo CARLOS SOLIS MORELOS JULIAN CRUZ OLIVARES MARIA TERESA RAMIREZ SILVA Manuel Eduardo Palomar Pardavé (2014)

El presente libro tiene como finalidad compilar numerosas investigaciones en el campo de la tecnología electroquímica y sus aplicaciones ambientales, contando con la colaboración de un gran número de investigadores tanto nacionales como extranjeros, proponiendo con ello una visión amplia dentro de la aplicación de la electroquímica. Los temas que integran esta obra se escogieron cuidadosamente considerando desde los principios básicos de la electroquímica aplicada al tratamiento de aguas residuales hasta los parámetros a considerar durante el diseño, operación y evaluación de dichos sistemas, sin dejar de lado las aplicaciones utilizadas en la actualidad en la industria, la docencia y la investigación. Este libro reúne diversas temáticas por lo que puede considerarse como un compendio de aquellos elementos que el lector requiere para poder tener una visión amplia de las aplicaciones de la electroquímica en el campo del tratamiento de agua residual.

En el Capítulo 1 se presenta una primera impresión de los Fundamentes de la Electroquímica Ambiental, en donde los autores explican cómo esta disciplina es una nueva área de la ciencia en donde se emplean conocimientos de Electroquímica, Ingeniería Química y Ciencia de Materiales, así como las aplicaciones específicas para la remediación ambiental. En el Capítulo 2 los autores ofrecen una descripción de los principales parámetros fisicoquímicos y biológicos que se emplean para definir a la calidad del agua. Este capítulo describe en función de qué características físicas, químicas y biológicas se puede evaluar a un agua residual así como también la aplicación de estas características como variables de control de un proceso de tratamiento y también como el empleo de ellas para limitar las concentraciones máximas permisibles de descarga de aguas residuales. El Capítulo 3 se refiere a uno de los procesos más empleados en el tratamiento de agua: la coagulación-floculación. Se aborda desde una óptica teórica hasta la descripción de un ejemplo de aplicación en la industria. Resulta importante incluir este capítulo ya que uno de los métodos más prometedores en la electroquímica ambiental es la electrocoagulación, la cual se narra en el Capítulo 6. Las bases de las celdas de laboratorio y reactores industriales electroquímicos se relatan en el Capítulo 4. En particular, se refieren las implicaciones que tienen las principales características físicas y de diseño de celdas de laboratorio y reactores electroquímicos industriales que permiten obtener transformaciones eficientes gracias a un correcto control del potencial de electrodo en estos sistemas. La implementación de procesos electroquímicos para su aplicación a nivel industrial, requiere del diseño eficiente del dispositivo central: el reactor electroquímico. Por lo que, en el Capítulo 5 se presentan los elementos de análisis de reactores electroquímicos para su diseño y caracterización. El Capítulo 7 describe bajo qué circunstancias se puede llevar a cabo el proceso de electroflotación. Los autores muestran cómo este proceso está influenciado por el pH de la solución acuosa, la densidad de corriente y el tipo de electrodos que se emplean. El lector encontrará en el Capítulo 8 las bases teóricas de uno de los procesos que involucra la química de la reacción de Fenton, así como las aplicaciones ambientales para el tratamiento de soluciones sintéticas y reales con diferentes contaminantes refractarios, tales como plaguicidas, colorantes, productos de cuidado personal, fármacos y residuos químicos industriales. En el Capítulo 9 se presentan algunos conceptos fundamentales sobre la Electrooxidación, también conocida como oxidación electroquímica, la cual está enfocada a realizar la oxidación de contaminantes presentes en aguas residuales sobre la superficie de electrodos. La tecnología para la electrogeneración de peróxido de hidrógeno y su empleo en el tratamiento de agua residual se describe en el Capítulo 10. Uno de los metales pesados que tienen un alto grado de toxicidad en el ambiente es el Cr(VI), el cual no puede ser removido por métodos convencionales por lo que una tecnología que puede emplearse en este tratamiento se relata en el Capítulo 11. En el Capítulo 12 se presentan los avances más recientes cuando se emplean los métodos electroquímicos con algún otro tipo de tratamiento, lo que ha resultado en la obtención de sinergias en los procesos, lo que implica una reducción en los costos de operación. Finalmente, en el Capítulo 13, se presenta el tema de usos y aplicaciones de sensores químicos y electroquímicos para la detección de contaminantes en agua y agua residual.

Book

Aplicaciones electroquímicas aguas residuales sensores químicos BIOLOGÍA Y QUÍMICA